ID: 1086505409

View in Genome Browser
Species Human (GRCh38)
Location 11:87498671-87498693
Sequence CCTTCAGATGGGGTTTTTTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1086505409_1086505415 4 Left 1086505409 11:87498671-87498693 CCACAAAAAACCCCATCTGAAGG No data
Right 1086505415 11:87498698-87498720 CAACATCAAAGACCAAAGATAGG No data
1086505409_1086505417 23 Left 1086505409 11:87498671-87498693 CCACAAAAAACCCCATCTGAAGG No data
Right 1086505417 11:87498717-87498739 TAGGTAAATCCACGAAGATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086505409 Original CRISPR CCTTCAGATGGGGTTTTTTG TGG (reversed) Intergenic