ID: 1086506767

View in Genome Browser
Species Human (GRCh38)
Location 11:87513254-87513276
Sequence AGGGAGAATATTCCAGAAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1086506767_1086506771 8 Left 1086506767 11:87513254-87513276 CCATTTTCTGGAATATTCTCCCT No data
Right 1086506771 11:87513285-87513307 GCAGTATTTAGTAAGGTATTTGG No data
1086506767_1086506770 1 Left 1086506767 11:87513254-87513276 CCATTTTCTGGAATATTCTCCCT No data
Right 1086506770 11:87513278-87513300 TATCAGTGCAGTATTTAGTAAGG No data
1086506767_1086506773 24 Left 1086506767 11:87513254-87513276 CCATTTTCTGGAATATTCTCCCT No data
Right 1086506773 11:87513301-87513323 TATTTGGGAAACACCCTGCCAGG No data
1086506767_1086506774 28 Left 1086506767 11:87513254-87513276 CCATTTTCTGGAATATTCTCCCT No data
Right 1086506774 11:87513305-87513327 TGGGAAACACCCTGCCAGGCTGG No data
1086506767_1086506776 30 Left 1086506767 11:87513254-87513276 CCATTTTCTGGAATATTCTCCCT No data
Right 1086506776 11:87513307-87513329 GGAAACACCCTGCCAGGCTGGGG No data
1086506767_1086506772 9 Left 1086506767 11:87513254-87513276 CCATTTTCTGGAATATTCTCCCT No data
Right 1086506772 11:87513286-87513308 CAGTATTTAGTAAGGTATTTGGG No data
1086506767_1086506775 29 Left 1086506767 11:87513254-87513276 CCATTTTCTGGAATATTCTCCCT No data
Right 1086506775 11:87513306-87513328 GGGAAACACCCTGCCAGGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086506767 Original CRISPR AGGGAGAATATTCCAGAAAA TGG (reversed) Intergenic