ID: 1086506769

View in Genome Browser
Species Human (GRCh38)
Location 11:87513274-87513296
Sequence ACTAAATACTGCACTGATAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1086506769_1086506775 9 Left 1086506769 11:87513274-87513296 CCTGTATCAGTGCAGTATTTAGT No data
Right 1086506775 11:87513306-87513328 GGGAAACACCCTGCCAGGCTGGG No data
1086506769_1086506774 8 Left 1086506769 11:87513274-87513296 CCTGTATCAGTGCAGTATTTAGT No data
Right 1086506774 11:87513305-87513327 TGGGAAACACCCTGCCAGGCTGG No data
1086506769_1086506776 10 Left 1086506769 11:87513274-87513296 CCTGTATCAGTGCAGTATTTAGT No data
Right 1086506776 11:87513307-87513329 GGAAACACCCTGCCAGGCTGGGG No data
1086506769_1086506773 4 Left 1086506769 11:87513274-87513296 CCTGTATCAGTGCAGTATTTAGT No data
Right 1086506773 11:87513301-87513323 TATTTGGGAAACACCCTGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086506769 Original CRISPR ACTAAATACTGCACTGATAC AGG (reversed) Intergenic