ID: 1086506773

View in Genome Browser
Species Human (GRCh38)
Location 11:87513301-87513323
Sequence TATTTGGGAAACACCCTGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1086506768_1086506773 5 Left 1086506768 11:87513273-87513295 CCCTGTATCAGTGCAGTATTTAG No data
Right 1086506773 11:87513301-87513323 TATTTGGGAAACACCCTGCCAGG No data
1086506769_1086506773 4 Left 1086506769 11:87513274-87513296 CCTGTATCAGTGCAGTATTTAGT No data
Right 1086506773 11:87513301-87513323 TATTTGGGAAACACCCTGCCAGG No data
1086506767_1086506773 24 Left 1086506767 11:87513254-87513276 CCATTTTCTGGAATATTCTCCCT No data
Right 1086506773 11:87513301-87513323 TATTTGGGAAACACCCTGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086506773 Original CRISPR TATTTGGGAAACACCCTGCC AGG Intergenic