ID: 1086506995 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 11:87515521-87515543 |
| Sequence | GAATTTATGCATTGGGTGGG GGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1086506988_1086506995 | -8 | Left | 1086506988 | 11:87515506-87515528 | CCATGGCTGAAAAGGGAATTTAT | No data | ||
| Right | 1086506995 | 11:87515521-87515543 | GAATTTATGCATTGGGTGGGGGG | No data | ||||
| 1086506985_1086506995 | 2 | Left | 1086506985 | 11:87515496-87515518 | CCATCTGATACCATGGCTGAAAA | No data | ||
| Right | 1086506995 | 11:87515521-87515543 | GAATTTATGCATTGGGTGGGGGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1086506995 | Original CRISPR | GAATTTATGCATTGGGTGGG GGG | Intergenic | ||
| No off target data available for this crispr | |||||