ID: 1086506995

View in Genome Browser
Species Human (GRCh38)
Location 11:87515521-87515543
Sequence GAATTTATGCATTGGGTGGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1086506988_1086506995 -8 Left 1086506988 11:87515506-87515528 CCATGGCTGAAAAGGGAATTTAT No data
Right 1086506995 11:87515521-87515543 GAATTTATGCATTGGGTGGGGGG No data
1086506985_1086506995 2 Left 1086506985 11:87515496-87515518 CCATCTGATACCATGGCTGAAAA No data
Right 1086506995 11:87515521-87515543 GAATTTATGCATTGGGTGGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086506995 Original CRISPR GAATTTATGCATTGGGTGGG GGG Intergenic
No off target data available for this crispr