ID: 1086510542

View in Genome Browser
Species Human (GRCh38)
Location 11:87553150-87553172
Sequence TGTGCTCAACTGGGCTCAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1086510542_1086510547 20 Left 1086510542 11:87553150-87553172 CCTCCTGAGCCCAGTTGAGCACA No data
Right 1086510547 11:87553193-87553215 TATTTTCTCAGTTCAGTTAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086510542 Original CRISPR TGTGCTCAACTGGGCTCAGG AGG (reversed) Intergenic
No off target data available for this crispr