ID: 1086512319

View in Genome Browser
Species Human (GRCh38)
Location 11:87572374-87572396
Sequence ATCAGGCATATGTACAAACT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1086512313_1086512319 15 Left 1086512313 11:87572336-87572358 CCTATTTAGAATATGCTGCTCCT No data
Right 1086512319 11:87572374-87572396 ATCAGGCATATGTACAAACTGGG No data
1086512316_1086512319 -5 Left 1086512316 11:87572356-87572378 CCTCTGGTGGAGTTAAATATCAG No data
Right 1086512319 11:87572374-87572396 ATCAGGCATATGTACAAACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086512319 Original CRISPR ATCAGGCATATGTACAAACT GGG Intergenic
No off target data available for this crispr