ID: 1086513093

View in Genome Browser
Species Human (GRCh38)
Location 11:87581827-87581849
Sequence CTTTGGATATGTACTGAGTA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1086513090_1086513093 28 Left 1086513090 11:87581776-87581798 CCAATAAACATCTGGATGCAAAT No data
Right 1086513093 11:87581827-87581849 CTTTGGATATGTACTGAGTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086513093 Original CRISPR CTTTGGATATGTACTGAGTA GGG Intergenic
No off target data available for this crispr