ID: 1086515134

View in Genome Browser
Species Human (GRCh38)
Location 11:87603117-87603139
Sequence GATGTTGATTTTTAAAAATT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1086515133_1086515134 23 Left 1086515133 11:87603071-87603093 CCATTGTCTATTTGTATATTCAG No data
Right 1086515134 11:87603117-87603139 GATGTTGATTTTTAAAAATTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086515134 Original CRISPR GATGTTGATTTTTAAAAATT AGG Intergenic
No off target data available for this crispr