ID: 1086527936

View in Genome Browser
Species Human (GRCh38)
Location 11:87750960-87750982
Sequence CAATTGCATCCCATTTACCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1086527934_1086527936 0 Left 1086527934 11:87750937-87750959 CCTAAGACTAAGAGTTTTTTTGG No data
Right 1086527936 11:87750960-87750982 CAATTGCATCCCATTTACCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086527936 Original CRISPR CAATTGCATCCCATTTACCC AGG Intergenic
No off target data available for this crispr