ID: 1086543222

View in Genome Browser
Species Human (GRCh38)
Location 11:87938140-87938162
Sequence CAGGTGTTAAAGAGGCCAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1086543222_1086543234 14 Left 1086543222 11:87938140-87938162 CCATTTGGCCTCTTTAACACCTG No data
Right 1086543234 11:87938177-87938199 TGTTATTGCTTTTTGGGGATGGG No data
1086543222_1086543228 7 Left 1086543222 11:87938140-87938162 CCATTTGGCCTCTTTAACACCTG No data
Right 1086543228 11:87938170-87938192 GACTCCCTGTTATTGCTTTTTGG No data
1086543222_1086543229 8 Left 1086543222 11:87938140-87938162 CCATTTGGCCTCTTTAACACCTG No data
Right 1086543229 11:87938171-87938193 ACTCCCTGTTATTGCTTTTTGGG No data
1086543222_1086543233 13 Left 1086543222 11:87938140-87938162 CCATTTGGCCTCTTTAACACCTG No data
Right 1086543233 11:87938176-87938198 CTGTTATTGCTTTTTGGGGATGG No data
1086543222_1086543230 9 Left 1086543222 11:87938140-87938162 CCATTTGGCCTCTTTAACACCTG No data
Right 1086543230 11:87938172-87938194 CTCCCTGTTATTGCTTTTTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086543222 Original CRISPR CAGGTGTTAAAGAGGCCAAA TGG (reversed) Intergenic
No off target data available for this crispr