ID: 1086543228

View in Genome Browser
Species Human (GRCh38)
Location 11:87938170-87938192
Sequence GACTCCCTGTTATTGCTTTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1086543220_1086543228 9 Left 1086543220 11:87938138-87938160 CCCCATTTGGCCTCTTTAACACC No data
Right 1086543228 11:87938170-87938192 GACTCCCTGTTATTGCTTTTTGG No data
1086543221_1086543228 8 Left 1086543221 11:87938139-87938161 CCCATTTGGCCTCTTTAACACCT No data
Right 1086543228 11:87938170-87938192 GACTCCCTGTTATTGCTTTTTGG No data
1086543222_1086543228 7 Left 1086543222 11:87938140-87938162 CCATTTGGCCTCTTTAACACCTG No data
Right 1086543228 11:87938170-87938192 GACTCCCTGTTATTGCTTTTTGG No data
1086543225_1086543228 -1 Left 1086543225 11:87938148-87938170 CCTCTTTAACACCTGAGATGGGG No data
Right 1086543228 11:87938170-87938192 GACTCCCTGTTATTGCTTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086543228 Original CRISPR GACTCCCTGTTATTGCTTTT TGG Intergenic
No off target data available for this crispr