ID: 1086543234

View in Genome Browser
Species Human (GRCh38)
Location 11:87938177-87938199
Sequence TGTTATTGCTTTTTGGGGAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1086543227_1086543234 -5 Left 1086543227 11:87938159-87938181 CCTGAGATGGGGACTCCCTGTTA No data
Right 1086543234 11:87938177-87938199 TGTTATTGCTTTTTGGGGATGGG No data
1086543222_1086543234 14 Left 1086543222 11:87938140-87938162 CCATTTGGCCTCTTTAACACCTG No data
Right 1086543234 11:87938177-87938199 TGTTATTGCTTTTTGGGGATGGG No data
1086543220_1086543234 16 Left 1086543220 11:87938138-87938160 CCCCATTTGGCCTCTTTAACACC No data
Right 1086543234 11:87938177-87938199 TGTTATTGCTTTTTGGGGATGGG No data
1086543225_1086543234 6 Left 1086543225 11:87938148-87938170 CCTCTTTAACACCTGAGATGGGG No data
Right 1086543234 11:87938177-87938199 TGTTATTGCTTTTTGGGGATGGG No data
1086543221_1086543234 15 Left 1086543221 11:87938139-87938161 CCCATTTGGCCTCTTTAACACCT No data
Right 1086543234 11:87938177-87938199 TGTTATTGCTTTTTGGGGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086543234 Original CRISPR TGTTATTGCTTTTTGGGGAT GGG Intergenic
No off target data available for this crispr