ID: 1086547458

View in Genome Browser
Species Human (GRCh38)
Location 11:88014664-88014686
Sequence CCTGACAACCATGTGTTTTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1086547449_1086547458 7 Left 1086547449 11:88014634-88014656 CCTACCCTGCTGGCAAGGCCTGG No data
Right 1086547458 11:88014664-88014686 CCTGACAACCATGTGTTTTGGGG No data
1086547451_1086547458 3 Left 1086547451 11:88014638-88014660 CCCTGCTGGCAAGGCCTGGTTTG No data
Right 1086547458 11:88014664-88014686 CCTGACAACCATGTGTTTTGGGG No data
1086547444_1086547458 19 Left 1086547444 11:88014622-88014644 CCATCACCCATACCTACCCTGCT No data
Right 1086547458 11:88014664-88014686 CCTGACAACCATGTGTTTTGGGG No data
1086547443_1086547458 20 Left 1086547443 11:88014621-88014643 CCCATCACCCATACCTACCCTGC No data
Right 1086547458 11:88014664-88014686 CCTGACAACCATGTGTTTTGGGG No data
1086547452_1086547458 2 Left 1086547452 11:88014639-88014661 CCTGCTGGCAAGGCCTGGTTTGT No data
Right 1086547458 11:88014664-88014686 CCTGACAACCATGTGTTTTGGGG No data
1086547446_1086547458 13 Left 1086547446 11:88014628-88014650 CCCATACCTACCCTGCTGGCAAG No data
Right 1086547458 11:88014664-88014686 CCTGACAACCATGTGTTTTGGGG No data
1086547447_1086547458 12 Left 1086547447 11:88014629-88014651 CCATACCTACCCTGCTGGCAAGG No data
Right 1086547458 11:88014664-88014686 CCTGACAACCATGTGTTTTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086547458 Original CRISPR CCTGACAACCATGTGTTTTG GGG Intergenic
No off target data available for this crispr