ID: 1086547693

View in Genome Browser
Species Human (GRCh38)
Location 11:88017158-88017180
Sequence CCTTTCCTCTCTCATGTCCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1086547693_1086547699 29 Left 1086547693 11:88017158-88017180 CCATGGACATGAGAGAGGAAAGG No data
Right 1086547699 11:88017210-88017232 GGATCAGAATTCTTATCCATTGG No data
1086547693_1086547698 8 Left 1086547693 11:88017158-88017180 CCATGGACATGAGAGAGGAAAGG No data
Right 1086547698 11:88017189-88017211 CTCAGAATACATTTAGGGGTAGG No data
1086547693_1086547697 4 Left 1086547693 11:88017158-88017180 CCATGGACATGAGAGAGGAAAGG No data
Right 1086547697 11:88017185-88017207 TTTACTCAGAATACATTTAGGGG No data
1086547693_1086547695 2 Left 1086547693 11:88017158-88017180 CCATGGACATGAGAGAGGAAAGG No data
Right 1086547695 11:88017183-88017205 AGTTTACTCAGAATACATTTAGG No data
1086547693_1086547696 3 Left 1086547693 11:88017158-88017180 CCATGGACATGAGAGAGGAAAGG No data
Right 1086547696 11:88017184-88017206 GTTTACTCAGAATACATTTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086547693 Original CRISPR CCTTTCCTCTCTCATGTCCA TGG (reversed) Intergenic