ID: 1086547695

View in Genome Browser
Species Human (GRCh38)
Location 11:88017183-88017205
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1086547693_1086547695 2 Left 1086547693 11:88017158-88017180 CCATGGACATGAGAGAGGAAAGG No data
Right 1086547695 11:88017183-88017205 AGTTTACTCAGAATACATTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086547695 Original CRISPR AGTTTACTCAGAATACATTT AGG Intergenic