ID: 1086547696

View in Genome Browser
Species Human (GRCh38)
Location 11:88017184-88017206
Sequence GTTTACTCAGAATACATTTA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1086547693_1086547696 3 Left 1086547693 11:88017158-88017180 CCATGGACATGAGAGAGGAAAGG No data
Right 1086547696 11:88017184-88017206 GTTTACTCAGAATACATTTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086547696 Original CRISPR GTTTACTCAGAATACATTTA GGG Intergenic