ID: 1086547697

View in Genome Browser
Species Human (GRCh38)
Location 11:88017185-88017207
Sequence TTTACTCAGAATACATTTAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1086547693_1086547697 4 Left 1086547693 11:88017158-88017180 CCATGGACATGAGAGAGGAAAGG No data
Right 1086547697 11:88017185-88017207 TTTACTCAGAATACATTTAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086547697 Original CRISPR TTTACTCAGAATACATTTAG GGG Intergenic