ID: 1086556497

View in Genome Browser
Species Human (GRCh38)
Location 11:88117305-88117327
Sequence TAGCAAAAGCATAAAAAGGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 385
Summary {0: 1, 1: 0, 2: 0, 3: 30, 4: 354}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1086556492_1086556497 14 Left 1086556492 11:88117268-88117290 CCTGACTGAGCTTACCTACTAGC 0: 1
1: 0
2: 0
3: 53
4: 896
Right 1086556497 11:88117305-88117327 TAGCAAAAGCATAAAAAGGTTGG 0: 1
1: 0
2: 0
3: 30
4: 354
1086556495_1086556497 0 Left 1086556495 11:88117282-88117304 CCTACTAGCAGGGTTTGTGTAAA 0: 1
1: 0
2: 1
3: 8
4: 88
Right 1086556497 11:88117305-88117327 TAGCAAAAGCATAAAAAGGTTGG 0: 1
1: 0
2: 0
3: 30
4: 354

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086556497 Original CRISPR TAGCAAAAGCATAAAAAGGT TGG Intronic
900815108 1:4837703-4837725 TACGAAAAGCATAAAAATTTAGG - Intergenic
902203334 1:14850228-14850250 TAGAAAAAGCATAAATAGGCTGG - Intronic
906475184 1:46164774-46164796 TAGCATAAGCAAAACCAGGTAGG - Intronic
906823257 1:48951209-48951231 CAGCAAAAGCATCAGAAGGTAGG + Intronic
906983641 1:50658949-50658971 TAGCAAAAGCATCAAAAGAGTGG + Intronic
908928664 1:69289064-69289086 TATCAAAGTCATAAAAAGTTAGG - Intergenic
909107949 1:71436226-71436248 TGGCAAAAAAAAAAAAAGGTGGG + Intronic
909479368 1:76114933-76114955 AAGAAAAAGAAAAAAAAGGTAGG + Intronic
909843174 1:80356034-80356056 TAGCAACTTCATAAAAGGGTTGG + Intergenic
909844194 1:80369998-80370020 CAGCAAAACCACAAAAATGTGGG - Intergenic
909975843 1:82045392-82045414 TAGCCAAACCATAAACAGTTTGG - Intergenic
910468650 1:87527178-87527200 TAGCAAACCCATAACATGGTCGG + Intergenic
913355869 1:117921579-117921601 TAGGAAAAGCAGAATAAGCTAGG + Intronic
915420940 1:155781067-155781089 GACCAGAAGCATAAAAAAGTAGG + Intronic
915790669 1:158666852-158666874 TAGGAGAAGCATAATGAGGTTGG + Intronic
916187171 1:162144846-162144868 TAGCAAAAGCTTAGATGGGTTGG - Intronic
917815150 1:178702071-178702093 TAGGTAAAACATTAAAAGGTAGG + Intergenic
918879760 1:190102095-190102117 TAGCAAAATAGTCAAAAGGTAGG - Intronic
919442695 1:197657109-197657131 TATCAAAAGAACAAAAAGGCAGG + Intronic
921549769 1:216520835-216520857 AAGCAGCAGCCTAAAAAGGTTGG - Intronic
923312838 1:232752650-232752672 CAGCAAAAAGATAAAAAGATGGG + Intergenic
923401827 1:233623215-233623237 TAGCAAGAAAAAAAAAAGGTTGG + Intronic
923442612 1:234035648-234035670 GAGTAAAAGCACAAAGAGGTAGG - Intronic
923889734 1:238199704-238199726 CAGCAAAAGCAAAAAAGGGAGGG - Intergenic
924615218 1:245606739-245606761 TAGCAAAAGGAAGAAAAGGCAGG + Intronic
1064776012 10:18778127-18778149 TGGCATAAGCATCAAAAAGTTGG - Intergenic
1064788458 10:18926808-18926830 AAGCAAAAGCATAGAATGATAGG + Intergenic
1065505533 10:26426707-26426729 CAGAAAAAGGATAAAAAGGTTGG + Intergenic
1067928154 10:50531829-50531851 AAGCAATAGCATGATAAGGTAGG + Intronic
1068409565 10:56637247-56637269 TAGCAACCGCATTAAAAAGTGGG - Intergenic
1070108914 10:73463434-73463456 TAGAAAAAGAATGAAAAGTTAGG - Intronic
1070169206 10:73920021-73920043 TAATAAAAGCATAAAAACGGTGG + Intronic
1070488930 10:76957589-76957611 GAGCATATGCATATAAAGGTTGG + Intronic
1070561062 10:77566879-77566901 AAGCAAAAGAAGGAAAAGGTGGG + Intronic
1071139048 10:82485787-82485809 CAGCAAAAGCAAAAAAAAATAGG + Intronic
1071216698 10:83412289-83412311 TAGTAAAAGTATTAAAAAGTAGG - Intergenic
1071465893 10:85939378-85939400 TAGCAAAAACCTACAAAGTTTGG + Intronic
1071502351 10:86212886-86212908 AACCAAAACCATAAAATGGTGGG + Intronic
1072185464 10:93033894-93033916 CAGCTAAAGGATAAAAAGTTAGG + Intronic
1072494725 10:95945641-95945663 TACCAAAAGCATAAAGATTTGGG - Intergenic
1073387721 10:103141024-103141046 CAGCAAAAGCAAAAACAAGTGGG - Intronic
1073846431 10:107560979-107561001 CGGAAAAAGCATGAAAAGGTAGG - Intergenic
1075098245 10:119487819-119487841 AAGCAAAAGTATTAAGAGGTAGG + Intergenic
1075221103 10:120585501-120585523 TGGCAAAAGGATAACAAGGATGG + Intronic
1076170233 10:128313115-128313137 TAAGAAAAACATAAAAAGGTTGG + Intergenic
1076390597 10:130098501-130098523 AAGCAAATGCATAAAATTGTTGG - Intergenic
1077707843 11:4505269-4505291 TAGCAAAAGCTTAGAAACATAGG - Intergenic
1078301678 11:10136860-10136882 TAGAAAAAGAAGAAAAAAGTGGG - Intronic
1079698778 11:23518261-23518283 TTACAAAAGAATGAAAAGGTTGG - Intergenic
1079771661 11:24468825-24468847 TAACAAAAGAATAAAAAATTGGG - Intergenic
1081012459 11:37832490-37832512 TAGCAGAAGCAAAGAAAGATCGG - Intergenic
1081552010 11:44122057-44122079 CAGAAAAAGAATAAACAGGTGGG - Intronic
1082234139 11:49802349-49802371 TATGAAATGCATAAAAATGTGGG + Intergenic
1084799034 11:71529163-71529185 AAGCAAATGCATAATTAGGTTGG + Intronic
1085035255 11:73296104-73296126 TAGCAAATGCATAACAGAGTTGG + Intronic
1086147367 11:83567355-83567377 TAGCAATAGAATAAAAAAGTTGG + Intronic
1086177997 11:83915365-83915387 TAGCAAAAGCAAACAAAACTAGG + Intronic
1086556497 11:88117305-88117327 TAGCAAAAGCATAAAAAGGTTGG + Intronic
1086617451 11:88839088-88839110 TATAAAATGCATAAAAATGTGGG - Intronic
1087271270 11:96114470-96114492 TTGCAAAAGCAGAGATAGGTGGG - Intronic
1087467036 11:98521734-98521756 TAGAAAAAACATTAAAATGTTGG + Intergenic
1087575915 11:99989452-99989474 TAGAAAAAGAAAAAAAAAGTTGG - Intronic
1089226293 11:116925251-116925273 AAACAAAAACAAAAAAAGGTGGG + Intronic
1090231442 11:125109312-125109334 CAGCAAAAGTATAAAAACATGGG + Intronic
1090376906 11:126296325-126296347 TAGCAAGAACATGAAAAAGTGGG - Intronic
1091728699 12:2864184-2864206 TAGAAAAGGCATAAAAACATAGG - Intronic
1092111991 12:5970557-5970579 GAGCAGAAGCACTAAAAGGTGGG + Intronic
1092699306 12:11209422-11209444 TGGGAAAAGAATAAAAGGGTAGG + Intergenic
1093337478 12:17923779-17923801 TAGCAATAACATAAAAATGGAGG + Intergenic
1094038230 12:26093629-26093651 TAGAGAAGGCATAAAAAGGAGGG - Intergenic
1095099809 12:38168669-38168691 TAGGAAAAGCATAGAAAGAAGGG + Intergenic
1095156335 12:38860038-38860060 CAGCAAAAGCAAAATTAGGTGGG + Intronic
1095197630 12:39340321-39340343 AAGAAAAAGCAAAAAAAGTTAGG - Exonic
1095406532 12:41872466-41872488 AATCAAAAGCAAAAAAAGGCAGG + Intergenic
1095413492 12:41949152-41949174 GAGAAAATGCATAATAAGGTTGG + Intergenic
1096251951 12:50039295-50039317 AAATAAAAGAATAAAAAGGTTGG + Intergenic
1097764130 12:63504293-63504315 AAGCAAAAACAGAAAAAAGTAGG - Intergenic
1098495310 12:71127795-71127817 TAGCAAAACCAGAAAAAGTAAGG - Intronic
1098572498 12:72004714-72004736 TAGCAAAAGCAGAAAGAAGATGG + Intronic
1098634890 12:72770452-72770474 TTGCAAAAGAATAAAAAATTCGG - Intergenic
1099586744 12:84526802-84526824 TAGCCAAAGCCTAAAAAGAGGGG + Intergenic
1099587522 12:84539441-84539463 TAGCAAATGAAGAAAGAGGTTGG - Intergenic
1100831060 12:98516640-98516662 ACGCAAAAGTATAAAAAGGCGGG - Intronic
1101359334 12:104011270-104011292 GAGCCAAAGCATTAAAATGTTGG + Intronic
1102063419 12:109952535-109952557 TAGGGACAGCCTAAAAAGGTTGG - Intronic
1102839064 12:116098274-116098296 AAACAAAAACATAAAAATGTGGG + Intronic
1106009270 13:25802352-25802374 TAGGAAAAGCATTGAAAGATGGG + Intronic
1106816224 13:33410303-33410325 AAGCAGAAGCAGAAAAATGTAGG + Intergenic
1108084464 13:46770915-46770937 TAGCTACAGAATAAAGAGGTAGG - Intergenic
1108122526 13:47204732-47204754 TAGGAAAAATATAAAAAGTTGGG + Intergenic
1109601255 13:64632182-64632204 TATCAATAGAATAAAAAGTTTGG + Intergenic
1109644030 13:65229069-65229091 TAACAAACACATAAAAAGGGTGG - Intergenic
1109878919 13:68445241-68445263 TAGAAAAAGCATAAAGGGCTTGG + Intergenic
1110001048 13:70200983-70201005 TAACATAAACATAACAAGGTGGG + Intergenic
1110084333 13:71358407-71358429 TGGCAAGAGCAAACAAAGGTGGG + Intergenic
1110141139 13:72131002-72131024 TAGAATAAGCATAATAAGGAAGG + Intergenic
1110414499 13:75237102-75237124 AAGCAAAAGCTGAAAATGGTAGG + Intergenic
1110737943 13:78960361-78960383 GAGAGAAAGCACAAAAAGGTAGG + Intergenic
1110773666 13:79380254-79380276 TAGCAAAAAGATAAAAAGACAGG + Intronic
1111340441 13:86878653-86878675 TAGCCAAAGTAGAAAAATGTGGG - Intergenic
1111458362 13:88512920-88512942 CAGCAAAAGCAGATAAGGGTGGG + Intergenic
1111826067 13:93269560-93269582 CAGAAAAAGCAAAAGAAGGTGGG - Intronic
1112862835 13:103854827-103854849 TAGCAAAAGCAAGAAATTGTTGG - Intergenic
1113209728 13:107962083-107962105 CAACAAATGCATAAAATGGTTGG + Intergenic
1114159538 14:20149098-20149120 TAGCAAAAGCAGAACAAAGAGGG - Intergenic
1114489663 14:23091432-23091454 TACCAAAAATACAAAAAGGTGGG + Intronic
1115001484 14:28425822-28425844 GAGAGAAAGCATAAAAATGTGGG - Intergenic
1115135649 14:30104594-30104616 TGGCACAAGCATAAAGAGATAGG - Intronic
1115368765 14:32588356-32588378 TTGCAAAAGCATAAATAAGAAGG - Intronic
1116000797 14:39240744-39240766 TAGTAAATGCATAAAATAGTTGG + Intronic
1116066379 14:39988426-39988448 TAGAAAAATTATAAATAGGTTGG - Intergenic
1116927786 14:50658654-50658676 TGTCATAAGCATAAAAAGGTTGG - Intronic
1117529532 14:56645873-56645895 TACCAAGAGGATAAAAGGGTAGG + Intronic
1117569159 14:57029014-57029036 TAGAAAAAGAAAAAAAAGATAGG - Intergenic
1118353596 14:64992089-64992111 TATCAGAGGCATAAAAAGTTGGG - Intronic
1118472317 14:66086050-66086072 CATCAAAAGCAAGAAAAGGTTGG + Intergenic
1118712827 14:68536747-68536769 TAGGAAAAGCAGCAAAAGGGGGG - Intronic
1120466858 14:84869395-84869417 TAGGAAAAGTAGAAAAAGGTAGG - Intergenic
1121161963 14:91751748-91751770 TAGCAAAAGTAAAAAAACTTGGG + Intronic
1123821936 15:24039069-24039091 TAGAAAAAGTAATAAAAGGTTGG + Intergenic
1124896465 15:33781843-33781865 TAGCAAAAAAAAAAAAAGGGGGG + Intronic
1125866793 15:43058671-43058693 TAGAAAAAGAATGAAAAGGTTGG - Intronic
1126204523 15:46030092-46030114 TATCAAAAATATAAAAATGTTGG - Intergenic
1128409808 15:67383561-67383583 TAGCAAGAGTATAAAAAGGCAGG - Intronic
1131703617 15:94968581-94968603 TAGAAAAAGCAAATATAGGTTGG + Intergenic
1132397419 15:101484308-101484330 TAGTAAAAGTATAAAAGTGTGGG - Intronic
1133946269 16:10351372-10351394 AAACAAAAACAAAAAAAGGTCGG - Intronic
1134541034 16:15065745-15065767 TTGCAAAAGAATTAGAAGGTTGG + Intronic
1135309843 16:21396820-21396842 TAGTAACCTCATAAAAAGGTTGG - Intergenic
1135362736 16:21828920-21828942 TAGTAACCTCATAAAAAGGTTGG - Intergenic
1135436486 16:22430289-22430311 TTGCAAAAGAATTAGAAGGTTGG + Intronic
1136149424 16:28337142-28337164 TAGTAACCTCATAAAAAGGTTGG - Intergenic
1136263771 16:29101626-29101648 TTGCAAAAGAATTAGAAGGTTGG - Intergenic
1136306588 16:29375944-29375966 TAGTAACCTCATAAAAAGGTTGG - Intergenic
1137837494 16:51607034-51607056 ATGCAAAACCATAAAAAGCTGGG + Intergenic
1137913232 16:52400359-52400381 GAGCAAAGACATAAAAATGTGGG + Intergenic
1138248800 16:55486933-55486955 TAGTAAAAGCATAAACAGGAAGG - Intronic
1142962793 17:3561522-3561544 TCGCAAAAAAAAAAAAAGGTCGG + Intergenic
1143210654 17:5184861-5184883 TAACAAAAGCAAACAAAGATGGG + Intronic
1143267330 17:5649641-5649663 AAGCAAAAATATAACAAGGTAGG - Intergenic
1144335389 17:14264570-14264592 TTGGAGAAGTATAAAAAGGTAGG - Intergenic
1146544397 17:33725729-33725751 CAGCAAAAGCATAAAAAAAGGGG - Intronic
1147699185 17:42381399-42381421 TAGCAAAAGAATAATAAGGAAGG - Intronic
1147710588 17:42461186-42461208 TAGCAAAAGCATGTAAAGATTGG - Intronic
1148992066 17:51674898-51674920 TAGCAGCAGCCTAAAAAGGATGG - Intronic
1150413335 17:64965632-64965654 TAGCAAATGCATAAAGAAGCAGG - Intergenic
1150798480 17:68259585-68259607 TAGCAAATGCATAAAGAAGCAGG + Intronic
1152027420 17:77820619-77820641 AAACAATAGCATAAAAAGGCAGG + Intergenic
1153091437 18:1349771-1349793 AAACAAAAACATAAATAGGTTGG + Intergenic
1153427738 18:4985439-4985461 TAGTAAGGCCATAAAAAGGTAGG - Intergenic
1153464833 18:5377879-5377901 CAGGAAAAGCAGAGAAAGGTGGG + Intergenic
1155311185 18:24525437-24525459 TAGCAAAAAAAAAAAAAAGTGGG - Intergenic
1155396288 18:25390096-25390118 TAGAAAAAGAATGGAAAGGTGGG + Intergenic
1156036767 18:32772844-32772866 TAGCAACAGCAAGAAAATGTAGG + Exonic
1156110852 18:33725424-33725446 AAGCAAAAGTAGAAAGAGGTAGG - Intronic
1156334164 18:36153336-36153358 AAGAAAAAGGATAAAAGGGTGGG - Intronic
1156373904 18:36495235-36495257 TCAAAAAAGCATAAAAAGGCCGG - Intronic
1156507022 18:37603661-37603683 AAGTAAAGGCATTAAAAGGTAGG + Intergenic
1156565180 18:38180191-38180213 TAGAAAAAGCATAATTAGGCCGG - Intergenic
1157003690 18:43557402-43557424 AATCAAAACCATAAAAAGGTAGG - Intergenic
1159105773 18:64000947-64000969 TAGCAGAGGAATAAAAATGTAGG + Intronic
1159256630 18:65955355-65955377 TAAAAAGAGCATAAAAACGTAGG - Intergenic
1159288704 18:66389223-66389245 TAACAATAGCACAAAAAGATGGG - Intergenic
1160207213 18:76844520-76844542 AAACAAAAACATAAAAAGCTTGG + Intronic
1160558518 18:79741291-79741313 CACCAAAAGCATAAAAGGATAGG - Intronic
1165039141 19:33056585-33056607 TAGGAAGAGCATAAAAATCTGGG + Intronic
1165865801 19:38937085-38937107 TTGCAAAAGCAAAAAAAAGGGGG - Intronic
1168431982 19:56288513-56288535 CAGCAAAAGCATCAAAAGTGGGG - Intronic
925408150 2:3621828-3621850 TATCAAAAACATAAAATGGGGGG - Intronic
925487712 2:4354388-4354410 TATCACAAGCATAAACAGCTGGG + Intergenic
926673697 2:15601012-15601034 AAGAAAAAGGATAAAAGGGTAGG - Intronic
927344494 2:22022080-22022102 TAGCAAAAGAAAAAAAAGGGAGG - Intergenic
927418261 2:22902633-22902655 TAGCAACAACCTAAAAAGATGGG + Intergenic
928743206 2:34380421-34380443 TTGCCAAAGGAAAAAAAGGTTGG - Intergenic
930130279 2:47842479-47842501 TAACAAAGGTATAAAAAGGGGGG + Intronic
930869496 2:56155512-56155534 TTGCAAAAGGGGAAAAAGGTGGG - Intergenic
931754293 2:65358721-65358743 CAGAAAAAACATAAAATGGTGGG + Intronic
933357903 2:81237018-81237040 TAGCAAAAGCAATAAATGGTTGG + Intergenic
934707123 2:96490299-96490321 TAACAAAAGCAAAAACAAGTGGG - Intergenic
935100072 2:99985898-99985920 AAGAAAAAAAATAAAAAGGTGGG + Intronic
935260172 2:101348239-101348261 TTGTAAAAGCAGAATAAGGTAGG - Exonic
935486970 2:103668992-103669014 TAGCAAAAAAATGAAATGGTTGG + Intergenic
935525097 2:104155996-104156018 CAGCAAAAGGAAAGAAAGGTAGG - Intergenic
936637522 2:114276284-114276306 TAGCAAAAGCAAAAATATTTTGG - Intergenic
937911517 2:127077921-127077943 AAGCAAAGGGAGAAAAAGGTGGG + Intronic
938209224 2:129452153-129452175 TAGAAAAAGAAGAAAAAAGTTGG + Intergenic
940391978 2:153142818-153142840 AATCAAAAGCAGAAAACGGTAGG + Intergenic
940768347 2:157814231-157814253 TATCACAAGGATAAAAAGGGGGG + Intronic
941035989 2:160569833-160569855 TATCAAAAATATAAAAATGTAGG + Intergenic
941295521 2:163734736-163734758 TAGCAAAAGAAAAAAAAGCATGG + Intronic
942262960 2:174189143-174189165 TTCAAAAAACATAAAAAGGTAGG + Intronic
943898879 2:193406380-193406402 TAGTAAAAGGATAATAAGTTGGG + Intergenic
944355145 2:198778728-198778750 TAGGAAAAGCATCAAGAGTTAGG - Intergenic
945119845 2:206445507-206445529 CAGCAAAAACATAATAAGGTAGG + Exonic
945988754 2:216375582-216375604 TTACAAAAGCATACAAAGTTTGG + Intergenic
946867077 2:224051371-224051393 GAGAAAAAGGAAAAAAAGGTAGG - Intergenic
1170533022 20:17313526-17313548 TAGGAAAAGCAGAGAAAGGCTGG + Intronic
1172985349 20:38983088-38983110 TACCAAAAATATAAAAACGTAGG - Intronic
1174713312 20:52729749-52729771 TAGAAAATGCATAAACAGGCTGG - Intergenic
1175013947 20:55768306-55768328 TTGTAAAAGAATAAACAGGTCGG + Intergenic
1177030489 21:15977434-15977456 ATGCAAAAGCATAAAGAGGGAGG - Intergenic
1180727134 22:17954584-17954606 TAGCAAAAGATTCAAAAGGCTGG + Intronic
1180848259 22:18996217-18996239 TAAGAAATGCATAATAAGGTGGG + Intergenic
1181340713 22:22177628-22177650 AAGCAGAAAAATAAAAAGGTAGG + Intergenic
1184365953 22:44051511-44051533 TAGCAACAGCAGGAAAAGGAAGG + Intronic
949487865 3:4557490-4557512 TAGCAAAAACAAAAAAAAGTGGG - Intronic
950982249 3:17319609-17319631 TGGTAAAAGCATAAACAGCTGGG + Intronic
951884119 3:27507415-27507437 TAGCTAAAGCATCAAAACTTTGG + Intergenic
952480596 3:33757330-33757352 AAGCAAAAGCAAAAAAAGGGTGG - Intergenic
952658105 3:35811330-35811352 TAGCAAAGTCATAAAATGTTAGG + Intergenic
952721734 3:36540730-36540752 TAGAAAAAGCAAAGAAAGGAAGG + Intronic
953067280 3:39485287-39485309 CAGCAAAAACACAAAAATGTAGG - Intronic
953455328 3:43036169-43036191 TAGCCAAAGCATACACAGGTTGG + Intronic
954007185 3:47601068-47601090 TATCAAAAGCTTAGAATGGTGGG + Intronic
954791821 3:53139081-53139103 AATCAAAAGAATAAAAAAGTGGG - Intergenic
955990493 3:64621802-64621824 AAGAAAAAGAAAAAAAAGGTAGG + Intronic
956150708 3:66239259-66239281 TGGCAAAAAAAAAAAAAGGTTGG - Intronic
957730591 3:84128586-84128608 TATCAAAAGCATCAAAATTTGGG + Intergenic
959508922 3:107187886-107187908 TATCAAAATCATACAAAGATAGG + Intergenic
959912542 3:111779806-111779828 TAGCAAAGGCAAAAAGAGGATGG - Intronic
960177977 3:114539898-114539920 TAGAAAAAAAAAAAAAAGGTGGG - Intronic
961110801 3:124281504-124281526 GAACAAAGGCATGAAAAGGTGGG - Intronic
961685220 3:128625267-128625289 TAGGAAAAACATGAAAAGATTGG - Intronic
961998612 3:131271792-131271814 TCTCAAAAAAATAAAAAGGTCGG + Intronic
963986471 3:151600574-151600596 TAACAAATGCATAAAAATGTAGG - Intergenic
965720647 3:171657590-171657612 CAACAAAAGAATAAAAAGTTGGG + Intronic
966464927 3:180220473-180220495 TAACAAAAGAAAAAAAAAGTAGG - Intergenic
966684411 3:182678533-182678555 TAGCAAAAAAAAAAAAAAGTGGG + Intergenic
967058773 3:185853050-185853072 TTGCAAAAAAACAAAAAGGTGGG - Intergenic
967341662 3:188405401-188405423 AAGCAAAAGAACTAAAAGGTGGG - Intronic
968833445 4:2945523-2945545 TAGCAGAAGCTTAAAAATGTAGG - Intronic
969083592 4:4639009-4639031 TACCAAAAAAAAAAAAAGGTGGG + Intergenic
970701212 4:18741710-18741732 AAGCAATAGCATACAAAGGTAGG + Intergenic
970701867 4:18750909-18750931 TAGCAGAAGCATGGAAAAGTAGG - Intergenic
972865898 4:43232172-43232194 TAGCAAAAGGATGACTAGGTGGG + Intergenic
973047215 4:45549659-45549681 TTGCAACAGTATTAAAAGGTGGG + Intergenic
975557382 4:75677856-75677878 ATGCAAAAGTATTAAAAGGTGGG + Intronic
975893279 4:79054851-79054873 TCACAAAAGGATAAAAGGGTGGG + Intergenic
975972928 4:80063891-80063913 TAGCATTAGCATGGAAAGGTAGG - Intronic
977720961 4:100239934-100239956 AACAAAAAGCATAAAAGGGTAGG + Intergenic
978755134 4:112293604-112293626 TAGCAATGGAATAAAAAGGAAGG - Intronic
979153787 4:117356195-117356217 TAGCAAATGCATAACAATATAGG + Intergenic
979164956 4:117517288-117517310 AAGCAACAGTATTAAAAGGTGGG + Intergenic
979896434 4:126163827-126163849 TAGAAAAAGTATGAAAAGGTAGG - Intergenic
980233546 4:130074500-130074522 TAGCAAGAGTATCAAAAAGTAGG + Intergenic
981276389 4:142902644-142902666 AAGCAAAAGCATACAAATATAGG - Intergenic
981546365 4:145898220-145898242 TTGCAAAAGCATACAAAGTCCGG - Intronic
983968953 4:173847499-173847521 AAGAGAAAGCAGAAAAAGGTCGG - Intergenic
984203761 4:176760928-176760950 TGGCAAAATCATACATAGGTAGG + Intronic
984204706 4:176772614-176772636 ATGCAAAAGCATTGAAAGGTGGG + Intronic
984217590 4:176933450-176933472 TAGAAAAACCATAAAAATTTAGG - Intergenic
985936853 5:3103810-3103832 TAGTAAAATCCCAAAAAGGTAGG + Intergenic
985998928 5:3614944-3614966 TCACAAAACCAGAAAAAGGTGGG - Intergenic
987425056 5:17763575-17763597 CAGCACAAGCACAAAGAGGTGGG - Intergenic
988171712 5:27665965-27665987 GAGCAAGAGAATAAAAAGCTGGG - Intergenic
989494621 5:42098071-42098093 TAGCAAAAGCAGTAAAAAGAAGG - Intergenic
989792886 5:45428739-45428761 TAGCAAAAAGATAGAAAGGCTGG + Intronic
990059967 5:51635717-51635739 CAGCAAAAGGAAAAAAAGGCAGG + Intergenic
990156937 5:52888236-52888258 AAGCAAAAACATAAGAAGGAAGG + Intronic
992291760 5:75286619-75286641 CAGCAAAAGGATAAAAAGAGAGG + Intergenic
992310746 5:75497002-75497024 AAGGAAAACCAAAAAAAGGTAGG + Intronic
992696202 5:79290254-79290276 CAGCTAAAGCTCAAAAAGGTAGG + Exonic
993149500 5:84142829-84142851 TCGCAAAAGAAAAAAAAGCTTGG - Intronic
993729370 5:91404236-91404258 TAACAGAAGTATAAAAACGTGGG + Intergenic
994742517 5:103638508-103638530 TAGCAGAAACATAAAATTGTTGG + Intergenic
995974524 5:118016779-118016801 TAGCAAAGGAAACAAAAGGTGGG + Intergenic
995993680 5:118272924-118272946 AGTCAAAAGGATAAAAAGGTGGG + Intergenic
996127771 5:119746024-119746046 CAGCAAAAGCATGAGAAGGCAGG - Intergenic
996247145 5:121278724-121278746 TTGCAGAAGCATAAACAGATTGG + Intergenic
996468625 5:123833336-123833358 TTGCAAAAGCACAGAAATGTTGG - Intergenic
998325827 5:141279093-141279115 GTGCAAAAGTATAACAAGGTTGG - Intergenic
998713907 5:144858993-144859015 TATCAGAAGAATAAAGAGGTTGG - Intergenic
998890679 5:146742532-146742554 TCGCAAAAACAGAAAAAAGTAGG - Intronic
1000965687 5:167653509-167653531 AAGCAAAAGAAAAAAAAAGTGGG - Intronic
1002042436 5:176524449-176524471 TACTAAAAGTATAAAAAGCTGGG + Intergenic
1002710858 5:181194240-181194262 AAGCAAAAACAAAAAAAGTTCGG + Exonic
1003246884 6:4389480-4389502 TAGCTAAAAAAAAAAAAGGTAGG + Intergenic
1003854579 6:10260294-10260316 TAAAAAAAGCAGAAAAAGGATGG + Intergenic
1004490478 6:16110315-16110337 TGGCAAAAGCAGAAATAGGAAGG + Intergenic
1004544109 6:16580792-16580814 TAGGAAAAGCGAAAAAATGTAGG - Intronic
1004582123 6:16964606-16964628 TAGCAAAAGCAGAACAGAGTCGG + Intergenic
1004928825 6:20441992-20442014 TAGCAAAAAAAAAAAAAGGTTGG - Intronic
1005647096 6:27850474-27850496 TAGCTAAACCATCAAAAGATTGG - Intronic
1006092262 6:31635030-31635052 GAGAAAAAGCAGAAAAAGGTAGG - Intronic
1006197297 6:32253229-32253251 TAACAAAAACATAAAAACATAGG + Intergenic
1006694319 6:35918504-35918526 AAGAAAAAGAAAAAAAAGGTAGG + Intronic
1008359863 6:50603320-50603342 TAACAAAAGGATAAGAAGCTTGG - Intergenic
1008613409 6:53204688-53204710 TATTAAAAGAATAAAAAGGCCGG + Intergenic
1009698983 6:67150236-67150258 TAGCAAAAGCAAAAAAAAAAAGG - Intergenic
1010041644 6:71391638-71391660 TAGCAAAAACAAAAACACGTCGG - Intergenic
1011208775 6:84931620-84931642 TAGAAAATGCATAAAAAGTCTGG - Intergenic
1012746500 6:103096773-103096795 TACCAAAAGCATGAAGAAGTAGG - Intergenic
1013800800 6:113939603-113939625 TAGCAAAAGTACAAAAACATGGG + Exonic
1013918423 6:115369472-115369494 CAGAAAAAGCATTAGAAGGTTGG + Intergenic
1014435062 6:121411660-121411682 TAGAAAAGACATAAAAAGGCCGG + Intergenic
1015061442 6:128971665-128971687 TAAGAAAAGCTGAAAAAGGTAGG + Intronic
1015387205 6:132637437-132637459 AATGAAAAGCAAAAAAAGGTAGG + Intergenic
1015427210 6:133085105-133085127 TAGCAATAGCAGAATAGGGTTGG + Intergenic
1016375534 6:143416821-143416843 TAGGAAAAGAACAAAAAGGACGG - Intergenic
1016609661 6:145974217-145974239 TAGAAAAAGCATACAGAGGCCGG + Intergenic
1017358846 6:153542341-153542363 TATCTAAACCATAAAAGGGTGGG - Intergenic
1017605864 6:156132346-156132368 TACAAAAAGCATTAAAAAGTGGG + Intergenic
1017944620 6:159084888-159084910 TAGCAAAATGATAACAACGTGGG - Intergenic
1018877182 6:167832751-167832773 GAGCAAAAGCACAAAAATTTTGG - Intronic
1019868808 7:3738487-3738509 TTGCAAAAGAATAACAAGATAGG - Intronic
1020406777 7:7844409-7844431 TAGCAGAGGCATAACTAGGTAGG - Intronic
1020424835 7:8053275-8053297 AAACAAAACCATGAAAAGGTAGG - Intronic
1021062660 7:16132756-16132778 TACCAAAAAAATAAAAAGTTAGG + Intronic
1021467343 7:20960017-20960039 AAGGAAAAGCATAAGAAGGAAGG - Intergenic
1021782965 7:24124177-24124199 TGCAAAAAGGATAAAAAGGTAGG + Intergenic
1021805161 7:24348226-24348248 GAGCAAAAATATAAAGAGGTGGG - Intergenic
1022264759 7:28743077-28743099 TAGTAAAAGCAAAATAAGCTGGG - Intronic
1022731282 7:33028703-33028725 TAGAAAAATCAGAAAAAGGATGG + Intronic
1025254789 7:57376779-57376801 TAGCAAAGACAAAAAAAGATTGG + Intergenic
1025717956 7:63981216-63981238 AAGCAAAAACAAAAAAAGTTGGG - Intergenic
1026519009 7:71098953-71098975 AAGCAAAAACATAAAAAACTGGG + Intergenic
1027650134 7:80856428-80856450 TAGCACAAGCAGAGAAAGGCTGG + Intronic
1028655495 7:93201372-93201394 GAGCAAAGGAATAAAAAGGTAGG - Intronic
1029820019 7:103137867-103137889 AAGGAAAACCAAAAAAAGGTTGG + Intronic
1030928873 7:115497156-115497178 AAGCAAAGGCACAGAAAGGTGGG + Intergenic
1031123634 7:117748754-117748776 TAGGAAAAACAGAAAAAGTTTGG - Intronic
1031325336 7:120389559-120389581 TAGAAACAGAATAGAAAGGTGGG - Intronic
1033522574 7:142176092-142176114 TAGCAAAAAAAAAAAAAGGGGGG + Intronic
1034021846 7:147652954-147652976 TTGAAAAAACATAAAAAGGTAGG - Intronic
1034482490 7:151333296-151333318 AAGAAAAAGGATAAAAGGGTGGG + Intergenic
1034683346 7:152947858-152947880 TAGCAAAAACCTAAAATGGAGGG - Intergenic
1036626588 8:10477881-10477903 TCGCAACAGCCCAAAAAGGTAGG + Intergenic
1037349453 8:17935065-17935087 TAGCAAGATGATAAGAAGGTAGG - Intronic
1038976068 8:32697647-32697669 TAGCACATACATAAATAGGTTGG - Intronic
1038999149 8:32960143-32960165 TAGGAAAAGGAAAAACAGGTTGG + Intergenic
1039465580 8:37783155-37783177 AAGAAAAAGAAAAAAAAGGTGGG + Intergenic
1040839175 8:51766123-51766145 TAGTAAAAGAATAAACAGCTCGG - Intronic
1041484137 8:58355797-58355819 TAGCAAAAGGAAAAAAATCTAGG - Intergenic
1041555743 8:59153059-59153081 TGGCAAAACTATAAAAAGATCGG - Intergenic
1042190668 8:66183482-66183504 TAGTAAAAGCATAAAAGCATGGG - Intergenic
1043763995 8:84105892-84105914 AAGCAAAAGAAAAAAAAAGTTGG + Intergenic
1043992258 8:86769911-86769933 TAGTCAAAGCATTAAAAAGTTGG + Intergenic
1045081997 8:98635989-98636011 TAGGGAAAGCATAAAAAAATAGG - Intronic
1045959046 8:107945573-107945595 TAGCAAAAGAATAAAAATTGGGG - Intronic
1046338044 8:112815318-112815340 ATTCAAAAGCATAATAAGGTAGG + Intronic
1046340330 8:112845938-112845960 TAGCAAAAGCCTGGAAACGTAGG + Intronic
1046740005 8:117817827-117817849 TAGCAAATGGAGAAAAAGGCCGG + Intronic
1046790438 8:118316224-118316246 TATCAAGAGCATATAAAAGTTGG + Intronic
1047427876 8:124763236-124763258 GAGAAAAAGGAAAAAAAGGTGGG - Intergenic
1050010095 9:1177091-1177113 ATGCAAAAGCATAAAAATGTTGG - Intergenic
1051049362 9:12913448-12913470 TAGCAAAAGTATAAAAACCCAGG - Intergenic
1052376266 9:27721227-27721249 AAGTAAAAGAAAAAAAAGGTAGG + Intergenic
1052748450 9:32464362-32464384 TAGTAAAAGTATAACGAGGTAGG - Intronic
1055128596 9:72749227-72749249 AAACAAAAGCATAAAAAGTGAGG + Intronic
1055150118 9:72986885-72986907 TAGCAAAAAAAAAAAAAGATGGG + Intronic
1056392149 9:86150269-86150291 TAGGCAAAGCATAAATAGGAAGG + Intergenic
1056881712 9:90400358-90400380 TAGCAAGAGAATAAAAAAGAGGG + Intergenic
1057609703 9:96529826-96529848 TTGAGAAAGAATAAAAAGGTTGG - Intronic
1057656661 9:96959468-96959490 TAGTAAAAAAATAAAAAGGGGGG + Intronic
1058369046 9:104243555-104243577 TAGTAAGAGCAGAAAAAGGGAGG - Intergenic
1058541233 9:106014556-106014578 TACCAAAAGTGGAAAAAGGTAGG - Intergenic
1060214884 9:121732779-121732801 AAGCAGAAGCACAGAAAGGTTGG - Intronic
1061309166 9:129751160-129751182 TACCAAAAACATAAAAAATTAGG + Intronic
1061691386 9:132334792-132334814 TTGCAAAAGAATAACAAGGCAGG + Intronic
1062134827 9:134920075-134920097 GAACAAAACCATAAAAAGATTGG + Intergenic
1062230086 9:135477314-135477336 TAGTAAAAAAATAAAAAGGCAGG + Intergenic
1062452402 9:136621132-136621154 TCGCAAGAGCAGAGAAAGGTTGG - Intergenic
1187241864 X:17521299-17521321 TAGCAAAAGCATAGAGAAATGGG - Intronic
1188117710 X:26265359-26265381 AAGCAAAATCATAAATAAGTGGG - Intergenic
1188363302 X:29283353-29283375 AATCAAAATCATAAAAAGATGGG + Intronic
1189222780 X:39386579-39386601 TGGGAAAAGTATAAAGAGGTTGG - Intergenic
1189622946 X:42862943-42862965 TGGTAAAAGAATAAAAAGTTTGG - Intergenic
1190312978 X:49130264-49130286 TAACAAAAGAATAAAAAAGAGGG + Intergenic
1190459328 X:50656268-50656290 CAACAAAAGCAAAAATAGGTTGG - Intronic
1190503626 X:51103512-51103534 TGGCAATAGCCTAAAAAGATAGG + Intergenic
1191929913 X:66360597-66360619 TAACAAAAGCACAATAAGTTTGG - Intergenic
1191949992 X:66579987-66580009 TAGCAAAAAGTTAAAAAGCTTGG - Intergenic
1191980781 X:66923320-66923342 AAGCAAAAACATAAAAATGAAGG - Intergenic
1193055778 X:77148452-77148474 GAGCAAAAGAATAGAAAGTTAGG + Intergenic
1193478874 X:82001696-82001718 TATCAAGATCATAAACAGGTTGG + Intergenic
1195488019 X:105432554-105432576 AAACAAAAGCAAAAAAAGGGGGG - Intronic
1196492807 X:116288742-116288764 TTGCTAAAGCATAAAAATGCAGG - Intergenic
1198049595 X:132937864-132937886 TATCAATAGAATAAAGAGGTAGG + Intronic
1198949314 X:142052634-142052656 TATAAAAAGCATAAAAATGTTGG - Intergenic
1199844925 X:151685366-151685388 TAATGAAAACATAAAAAGGTAGG + Intergenic
1200256900 X:154587333-154587355 TAGAAAAATCATTAAAAGGCCGG + Intergenic
1200260869 X:154617070-154617092 TAGAAAAATCATTAAAAGGCCGG - Intergenic
1200325331 X:155232082-155232104 TAGCAAAAATCTAAAAATGTGGG - Intronic
1200463275 Y:3483738-3483760 TAACAAAACCATTAAAATGTAGG + Intergenic
1202189002 Y:22221581-22221603 TACCAAAAGCATAAATAAGAAGG + Intergenic