ID: 1086558828

View in Genome Browser
Species Human (GRCh38)
Location 11:88143780-88143802
Sequence GCCTTCTACAAACTGAACTA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 108
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 102}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1086558825_1086558828 10 Left 1086558825 11:88143747-88143769 CCATGCAGAATAGAATGACATAT 0: 1
1: 0
2: 1
3: 13
4: 180
Right 1086558828 11:88143780-88143802 GCCTTCTACAAACTGAACTATGG 0: 1
1: 0
2: 0
3: 5
4: 102

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086558828 Original CRISPR GCCTTCTACAAACTGAACTA TGG Intronic
904604848 1:31692631-31692653 GCCTTCTGCACACTGAACAGGGG + Exonic
911536948 1:99111402-99111424 TCCTTCTAGAAAATGATCTAAGG - Intergenic
915125101 1:153658513-153658535 CCTTTCTACAACCTGAACTTTGG + Intergenic
920661897 1:207922572-207922594 GCCTTCTACTAAGGGGACTACGG + Intergenic
921686363 1:218093498-218093520 TCCTTCCACTCACTGAACTATGG + Intergenic
922028179 1:221772810-221772832 GCCTTCTCCCAACAAAACTAAGG + Intergenic
923828937 1:237532440-237532462 GCTTTCAAGAAACTGAACAAAGG - Intronic
1063244788 10:4206627-4206649 GTCTTCAACAAACTGAACCCAGG - Intergenic
1066454081 10:35558090-35558112 GCTTTCAACAAACTGAAGCAGGG - Intronic
1067908162 10:50316081-50316103 GCCATCTGCAAACTGAATGATGG - Intronic
1075964339 10:126598129-126598151 CCCTTCTGCAAACTGTCCTAGGG + Intronic
1078899316 11:15626894-15626916 TTTTTCTAAAAACTGAACTAAGG + Intergenic
1082751911 11:57028668-57028690 GACTTCTACAAACCGAAACAGGG - Intergenic
1084938107 11:72597928-72597950 GCCTGCTACAATCTGACCTTAGG + Intronic
1086558828 11:88143780-88143802 GCCTTCTACAAACTGAACTATGG + Intronic
1087661925 11:100998510-100998532 GTCTTCCACAAACGGAACTCAGG + Intergenic
1090083377 11:123629513-123629535 TCCTGCTGCAAACTCAACTAAGG + Exonic
1093871961 12:24303721-24303743 GCTTTCTACAAACAGAACACAGG - Intergenic
1096000313 12:48124269-48124291 GGTTTCTGCAAACTCAACTAGGG - Intronic
1098117397 12:67194304-67194326 GTCTTCCACAAACTGAACTGGGG - Intergenic
1100427876 12:94504044-94504066 GCCTCCTAGAAACTGATCAAGGG - Intergenic
1100872506 12:98924890-98924912 GCCTTCTACTCATTGAGCTATGG - Intronic
1108802337 13:54114946-54114968 GCCTCCTACAATCTGGACTGTGG + Intergenic
1110911794 13:80975084-80975106 GCATTTTAAAAACTGAACTATGG + Intergenic
1114053047 14:18939144-18939166 GCCTTTTATAACCTGTACTAAGG - Intergenic
1114109511 14:19462782-19462804 GCCTTTTATAACCTGTACTAAGG + Intergenic
1114481446 14:23037833-23037855 GCCTTCTCCTAACTGATTTATGG + Intergenic
1114819130 14:25995174-25995196 GCCTTCTATATGCTGATCTATGG - Intergenic
1115037378 14:28874853-28874875 TCCATCAACAAACTTAACTATGG - Intergenic
1117535984 14:56703933-56703955 GCCTTTTAAAAATTGAGCTAGGG + Intronic
1123150671 14:106178567-106178589 TCCTTCTCCAAACAGAAGTAAGG + Intergenic
1123202788 14:106682286-106682308 CCCTTCTTCAAACAGAAGTAAGG + Intergenic
1123399088 15:19966313-19966335 TCCTTCTCCAAACAGAAGTAAGG + Intergenic
1128702347 15:69813640-69813662 CAGTGCTACAAACTGAACTATGG + Intergenic
1129747026 15:78029638-78029660 AGCTTCTACAATGTGAACTATGG - Intronic
1131566087 15:93486729-93486751 GCTTTCTCCAAACTGACCCATGG - Intergenic
1140257773 16:73351482-73351504 GCCTTCTCCAAACTTCACTTGGG + Intergenic
1145942341 17:28749170-28749192 GCCTTCTACACACATAAGTATGG + Exonic
1147964285 17:44185743-44185765 GGCTTCTACCAACTGAACACTGG - Intergenic
1149264702 17:54914897-54914919 TCCTTCTTGGAACTGAACTATGG - Intronic
1156641286 18:39102941-39102963 GCCTTCAACATACTGAAGAATGG + Intergenic
1156702549 18:39842345-39842367 TTCTTCTACAAACAGAACAATGG + Intergenic
1157269445 18:46260209-46260231 GCCTTCTAGAAACTGATTCATGG + Intronic
1163853787 19:19683490-19683512 AACTTCTTCAAACTGAATTAAGG - Exonic
927597338 2:24408221-24408243 GTCTTCCACAAACTGGACTCAGG - Intergenic
931186305 2:59954771-59954793 ACCTTTTAGAAACTGAAATAAGG - Intergenic
935362782 2:102261723-102261745 GCAGTGTACAAACTGAACAACGG + Intergenic
936081432 2:109435189-109435211 GCCTTCAACATACTGACCTGGGG - Intronic
938740168 2:134224087-134224109 GCCATTTACAAACTGAACATGGG + Intronic
940820236 2:158345846-158345868 GCCTTCTAAAAACTTATCCAAGG - Intronic
941220252 2:162769523-162769545 GCCTTCTATAGACTATACTAAGG + Intronic
944126268 2:196296544-196296566 ACATTCTATAAACTGAACAAGGG + Intronic
944356534 2:198795901-198795923 CCTTTCTACAAACTGATTTAGGG - Intergenic
946007073 2:216534466-216534488 GCCTTCTGCCATCTGACCTAGGG - Intronic
1170444948 20:16416892-16416914 TCCTCCTCCAACCTGAACTAGGG - Intronic
1170977155 20:21175708-21175730 GCCTCCTAGAGACTTAACTAAGG - Intronic
1174442751 20:50569114-50569136 GCATGGTACAAAATGAACTATGG - Intronic
1180471520 22:15661519-15661541 GCCTTTTATAACCTGTACTAAGG - Intergenic
1181718557 22:24755092-24755114 TCATTCTCAAAACTGAACTAAGG + Intronic
1183867147 22:40712914-40712936 GCATTCTTCAAACAAAACTAGGG + Intergenic
950294102 3:11813112-11813134 ACTTTCTAGAAACTGAACAAGGG - Intronic
950788347 3:15453700-15453722 GCCTTCTAGACACTGAGGTATGG - Intronic
953847713 3:46441558-46441580 GCATTCCAAAAACTGAAATATGG + Intronic
954092870 3:48299330-48299352 GCATTTTATAAACTGGACTAAGG + Intronic
960991650 3:123315289-123315311 GCCTTCAACAAACGGAACAAGGG + Intronic
962988480 3:140557531-140557553 GGCTTCTGCAAACTGAAGAAAGG + Intronic
966979797 3:185121595-185121617 TAGTTCTACAAACTGAATTAAGG + Intronic
970794118 4:19891579-19891601 GCCATCTACAAACTAAATAAAGG - Intergenic
972574313 4:40338126-40338148 GCCATCTAGAAACTGACCTGTGG + Intronic
973693068 4:53460070-53460092 GCCTCCTAGAAACTACACTATGG - Intronic
974282124 4:59809246-59809268 GCTTTCTACTAACTGAGTTATGG + Intergenic
974542513 4:63256290-63256312 GCCTTTTAAAAAGTGATCTAAGG - Intergenic
974692778 4:65320777-65320799 CTCTTTTACAAACTGAATTAAGG + Exonic
975777639 4:77805772-77805794 GCCTTCTCCAGACTGAAGAAAGG + Intronic
980191872 4:129534944-129534966 GTATTTTACAAACTGAAATATGG - Intergenic
983728087 4:170955151-170955173 TCCTTCAACAAATTAAACTATGG - Intergenic
990723776 5:58730457-58730479 GCCTTCTACAACAGGAAATAAGG + Intronic
991911816 5:71570299-71570321 GCCTTCTGCAGAGAGAACTATGG - Intergenic
992228787 5:74643126-74643148 ACCTCCTACAAACTGTACTCTGG + Intronic
994770338 5:103973607-103973629 GACTTCTGCAATCTGAACCATGG + Intergenic
998345611 5:141459886-141459908 GCCTTCTTAAAATTGAGCTATGG + Intronic
998617108 5:143752394-143752416 GCCTTCTACACACATAAGTATGG - Intergenic
999254984 5:150205111-150205133 GCATTTAACCAACTGAACTAGGG - Intronic
999813691 5:155153948-155153970 AGCTTCTATAAACTGCACTATGG + Intergenic
1002205132 5:177557418-177557440 GCCATCTGCAAACTGGACTTTGG - Intergenic
1010369005 6:75085758-75085780 GGCTCCTAGAAACTGAACTCGGG + Exonic
1021052009 7:15997225-15997247 GGTTTCTACAAACTGTACTTAGG - Intergenic
1021812131 7:24413061-24413083 GCCATGTGCAAACTGAACTCTGG + Intergenic
1025818908 7:64945431-64945453 ACCTTTTCCAAACTGATCTAAGG - Intergenic
1027608700 7:80332353-80332375 GCCTTCCATCAACTAAACTATGG + Intergenic
1029566037 7:101338718-101338740 GCAGTCTACAACCTGAACAAGGG + Intergenic
1030378504 7:108782740-108782762 GCATTTTACAAGATGAACTAAGG - Intergenic
1030811199 7:113974350-113974372 GCCATCTTCAAACTGAGCAATGG - Intronic
1030892313 7:115014044-115014066 TCCTTCTACAAACACAACTCTGG + Intronic
1043766039 8:84133495-84133517 GCTTTCTAGAAACTGAAAGAAGG + Intergenic
1047297758 8:123586449-123586471 GCCTTCCACAAACTGAGGAATGG - Intergenic
1047906226 8:129476062-129476084 GCCTACTACACACTGGACCACGG + Intergenic
1048861144 8:138725132-138725154 GCCTTCTACATGCTGGACTCTGG + Intronic
1050022674 9:1301322-1301344 TCCTCCTACAAGCTGGACTAAGG + Intergenic
1056109339 9:83379567-83379589 TGATTCTACAAAATGAACTAGGG + Intronic
1059536848 9:115088523-115088545 GACTTCTGCAAACTGAGCTAAGG - Intronic
1061736581 9:132664757-132664779 GCCTTCTAGAATCTGACCTCTGG + Intronic
1062121884 9:134838325-134838347 CCCTTCTACACACAGAACTAAGG + Intronic
1187251286 X:17600525-17600547 GCATTCTAAAAACAGCACTAGGG + Intronic
1188764338 X:34073851-34073873 GCCTTCTCCAAAGGGACCTATGG + Intergenic
1191157507 X:57290225-57290247 GCATGCTACAAACTCAATTACGG + Intronic
1193983979 X:88218249-88218271 GCCTTCTCCAAAGGGATCTATGG + Intergenic
1194923651 X:99796983-99797005 GGCCTCTACAACCAGAACTATGG - Intergenic