ID: 1086561675

View in Genome Browser
Species Human (GRCh38)
Location 11:88175761-88175783
Sequence AGTACTCTGCGGGAGATGGC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1086561671_1086561675 12 Left 1086561671 11:88175726-88175748 CCACGTTTTGCTTGCGAGAAAAC No data
Right 1086561675 11:88175761-88175783 AGTACTCTGCGGGAGATGGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086561675 Original CRISPR AGTACTCTGCGGGAGATGGC CGG Intergenic
No off target data available for this crispr