ID: 1086562087

View in Genome Browser
Species Human (GRCh38)
Location 11:88179273-88179295
Sequence CTGTGGAGAACAGGTTTCCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1086562087_1086562090 -2 Left 1086562087 11:88179273-88179295 CCATGGAAACCTGTTCTCCACAG No data
Right 1086562090 11:88179294-88179316 AGTAATTCTCAAAACATCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086562087 Original CRISPR CTGTGGAGAACAGGTTTCCA TGG (reversed) Intergenic
No off target data available for this crispr