ID: 1086566942

View in Genome Browser
Species Human (GRCh38)
Location 11:88238124-88238146
Sequence GTTTTCTTGTGACTAAAACA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 441
Summary {0: 1, 1: 0, 2: 5, 3: 35, 4: 400}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1086566940_1086566942 13 Left 1086566940 11:88238088-88238110 CCTTAAGCAAGTAACTTGTCCTA 0: 1
1: 0
2: 2
3: 18
4: 305
Right 1086566942 11:88238124-88238146 GTTTTCTTGTGACTAAAACACGG 0: 1
1: 0
2: 5
3: 35
4: 400
1086566941_1086566942 -6 Left 1086566941 11:88238107-88238129 CCTAACTGAAGCTCTCTGTTTTC 0: 1
1: 0
2: 3
3: 26
4: 309
Right 1086566942 11:88238124-88238146 GTTTTCTTGTGACTAAAACACGG 0: 1
1: 0
2: 5
3: 35
4: 400
1086566939_1086566942 23 Left 1086566939 11:88238078-88238100 CCAATTTCATCCTTAAGCAAGTA 0: 1
1: 0
2: 1
3: 10
4: 222
Right 1086566942 11:88238124-88238146 GTTTTCTTGTGACTAAAACACGG 0: 1
1: 0
2: 5
3: 35
4: 400

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086566942 Original CRISPR GTTTTCTTGTGACTAAAACA CGG Intergenic
900058239 1:650816-650838 GATTTCTGATGACTAAAACCTGG - Intergenic
902041310 1:13494505-13494527 GTTTTCTTATGTATAAAACGTGG - Intronic
902117139 1:14130635-14130657 GCTTTCTGGTTACTAAAATAAGG - Intergenic
902877188 1:19347808-19347830 GTTTCCTTGGGTTTAAAACAGGG - Intronic
902893450 1:19461821-19461843 GTTTTCTTGTCTCTAAAACTAGG + Intronic
903343019 1:22666380-22666402 GTTTTCATGTTACAAAAAGAGGG - Intergenic
903406438 1:23100872-23100894 GTTTCCTTGTTTCTAAAATAAGG - Intronic
903698561 1:25228796-25228818 GTTTTCTCATCAATAAAACAGGG - Intronic
903745236 1:25582137-25582159 GTTTTCTTGTCTCTCAAATAAGG + Intergenic
904545004 1:31262577-31262599 GTTTTCTTATCTCTAAAATAAGG - Intronic
905513281 1:38541500-38541522 GTTTCCTGGTGTCTTAAACAGGG + Intergenic
905815191 1:40944533-40944555 GTATTCTTGTGCGTAAACCAGGG + Intergenic
906160527 1:43645781-43645803 GTTTTCTCATAACTAAAACTGGG - Intergenic
907075170 1:51571658-51571680 GTTTTGTTTTGATTAAGACAGGG - Intergenic
907722732 1:56987143-56987165 ATTTTTTTCTGACTAAAAAAAGG + Intergenic
907804936 1:57809403-57809425 GTTTTCTTGTCTATAAAACAGGG - Intronic
908804876 1:67919826-67919848 GTTTTCTTGTAGCTAAGACCAGG + Intergenic
911656240 1:100447253-100447275 ATTTTCATGTGACTTAAAAATGG + Intronic
912719708 1:112009771-112009793 GTTTTGTTATAACTAAAAAAAGG - Intergenic
912831038 1:112954425-112954447 GTTTCCTTATGTGTAAAACAAGG + Intronic
912937069 1:114012827-114012849 GTTTTCTTGTCAGTAAATAAAGG + Intergenic
913560763 1:120016851-120016873 ATCTACTTGTGATTAAAACATGG + Intronic
913637364 1:120776752-120776774 ATCTACTTGTGATTAAAACATGG - Intergenic
914281345 1:146176266-146176288 ATCTACTTGTGATTAAAACATGG + Intronic
914542390 1:148627201-148627223 ATCTACTTGTGATTAAAACATGG + Intronic
914624243 1:149444044-149444066 ATCTACTTGTGATTAAAACATGG - Intergenic
914766483 1:150642015-150642037 TTTTTCTTGTGGCAGAAACATGG + Intergenic
914845200 1:151280084-151280106 GTTTTCTCATGAGTAAAACGGGG - Exonic
916607292 1:166355642-166355664 GTTTTCTTGTCAATAAAATGTGG - Intergenic
916976678 1:170088099-170088121 GTTTTCTCGTCAGTAAAATATGG - Intergenic
917169175 1:172150754-172150776 GTTTTCTCATCTCTAAAACAGGG + Intronic
917171454 1:172180364-172180386 GTTTCCTTGTGAGTAAAATGAGG - Intronic
917944771 1:179957961-179957983 GTTTTCTTATGTATAAAATATGG - Intronic
918583176 1:186156470-186156492 GTTATTTTCTGACTATAACAAGG + Intronic
918586138 1:186190972-186190994 GTTTCCTTGCAGCTAAAACAGGG + Intergenic
919337798 1:196262933-196262955 GTTTTCTTGTCATGAAGACAGGG - Intronic
919498158 1:198302875-198302897 GTGTTCTTGTAACACAAACAGGG - Intronic
920016083 1:202910181-202910203 GCTTTCTTATGTGTAAAACAGGG - Intronic
920932126 1:210398907-210398929 GTTTTCTTGGAACTTAAAAATGG + Intronic
921534828 1:216333763-216333785 GATTTCTTGTGAAGAAACCATGG + Intronic
922323218 1:224505592-224505614 GTTTTCTTGTGGGTAAAATGGGG - Intronic
923552964 1:234978871-234978893 GTGTTTTGGTGACTAAATCAAGG + Intergenic
923936700 1:238769035-238769057 GTCCTCTTGTGATTACAACATGG + Intergenic
1063122365 10:3114010-3114032 GTTTTCTTGTGAGGAAAATGGGG - Intronic
1063951350 10:11226214-11226236 GCTTCCTTGTCAGTAAAACAGGG - Intronic
1064546345 10:16453927-16453949 GTTTTCTCATTAATAAAACAAGG - Intronic
1065127910 10:22592091-22592113 GTTTTCTTCTGAATAAAATTAGG + Intronic
1065978639 10:30867752-30867774 GTTTCCTTGAGAATATAACATGG + Intronic
1068554570 10:58444724-58444746 GTTTACTTATGTGTAAAACAGGG - Intergenic
1069685599 10:70316433-70316455 CTTTTCTTGTGTTTTAAACAAGG + Intronic
1070201676 10:74212530-74212552 GTTTCCTTGTGAGTAAAATAAGG + Intronic
1070905049 10:80064639-80064661 GTTTCCTTGGCAATAAAACAAGG + Intergenic
1072771219 10:98140257-98140279 GTTTTCTTGTCTTTAAAATAGGG + Intronic
1072911014 10:99500740-99500762 GTTTTCTGGTATTTAAAACAAGG + Intergenic
1075500605 10:122970379-122970401 ATTTTTTTGTGACAAAAAAATGG + Intronic
1075539732 10:123302048-123302070 GTTTTCTTATGTGTAAAATAGGG + Intergenic
1075913170 10:126143873-126143895 GTTTGCTTGAGACTAAAACAAGG + Intronic
1077718449 11:4604015-4604037 GTTTTCTTGTCTATAAAATAAGG - Intronic
1078616195 11:12868319-12868341 TTTTCCTTCTGCCTAAAACAGGG - Intronic
1080474695 11:32579137-32579159 TTTTTTTTTTGCCTAAAACATGG - Intergenic
1080831605 11:35898498-35898520 TTTTTTTTGTTACTGAAACAAGG + Intergenic
1082845905 11:57725253-57725275 GTTTCCTTGGAAGTAAAACAGGG - Intronic
1083640087 11:64140724-64140746 GTTTTCTTGTCTGTAAAACAGGG - Intronic
1085662566 11:78382808-78382830 TTTTATTTGTTACTAAAACAAGG + Intronic
1086383057 11:86278949-86278971 GGTTCCTTGTGTATAAAACAGGG + Intergenic
1086566942 11:88238124-88238146 GTTTTCTTGTGACTAAAACACGG + Intergenic
1086663192 11:89447546-89447568 GTTTTCTTGTCTGTAAAATAGGG - Intronic
1088640926 11:111872129-111872151 GTTTCCTGGTAAATAAAACAAGG - Intergenic
1089783137 11:120888357-120888379 GTTTTCTTATCTGTAAAACAAGG + Intronic
1089926932 11:122268590-122268612 GTTTTCTTATCAGTAAAATAGGG - Intergenic
1092048487 12:5450434-5450456 GTTTCCTAATGGCTAAAACAAGG - Intronic
1092748544 12:11696403-11696425 GTTTTCTTGTGAGTAAAATAGGG + Intronic
1094026334 12:25963309-25963331 TTTTTTTTTTGGCTAAAACAAGG - Intronic
1095273011 12:40243015-40243037 GTTTTCTTGTTGGTAAAATAGGG - Intronic
1095368026 12:41431329-41431351 GGTTTCTCGTCTCTAAAACAGGG - Intronic
1096253428 12:50048303-50048325 GATTTTTTGTGACTTAAACTAGG - Intergenic
1097458861 12:59834929-59834951 TTTTTCTTATGATTAAACCAGGG + Intergenic
1097750151 12:63343206-63343228 GTTTTCTTATTTCTAAAACATGG - Intergenic
1097801379 12:63918271-63918293 GTTTTCTCATCTCTAAAACAGGG - Intronic
1099077926 12:78135019-78135041 GTTTTTTTATGACTAAAAAATGG - Intronic
1099177195 12:79435661-79435683 TTTTTCTTGTAACTGAAACAAGG - Intronic
1099211157 12:79790104-79790126 GTTCTCTTTTGTCTAAAGCAGGG + Intronic
1099644585 12:85336140-85336162 CTTTTCTTGAGATTAAAAAACGG + Intergenic
1100710672 12:97252822-97252844 GATGTCTTGTCACTAAAACATGG - Intergenic
1100954270 12:99889249-99889271 GTTTCCTTGTTTTTAAAACAAGG - Intronic
1101243865 12:102866032-102866054 ATTTTCTTTTGGCTAAAATAGGG + Intronic
1101454040 12:104810911-104810933 GTTCTATTTTTACTAAAACAAGG - Intronic
1103147187 12:118605067-118605089 CTTTTCTTGTAAGTGAAACATGG + Intergenic
1104447130 12:128843725-128843747 TTTTTGTTGTAACTAAAATAGGG + Intergenic
1106403202 13:29449519-29449541 GTTTTCTTATGTATAAAATATGG - Intronic
1107143156 13:37026320-37026342 ATATTACTGTGACTAAAACATGG - Intronic
1108570332 13:51743381-51743403 GTTTTCTTATCTCTAAAATAAGG + Intronic
1108585763 13:51868407-51868429 GTTTCCTTTTGGCTAAAACTCGG - Intergenic
1109582465 13:64360322-64360344 GTTTTCTTGTGATGAAACTAAGG + Intergenic
1109591983 13:64496603-64496625 GTTTTCTAGTCAATAGAACATGG - Intergenic
1109895833 13:68688140-68688162 GTTTTCTTGTAACACAAAAAAGG + Intergenic
1110291946 13:73817958-73817980 GCTTTTATGTCACTAAAACAAGG - Intronic
1113209166 13:107955190-107955212 GTTTTCTTATGTCTATAAAAGGG - Intergenic
1113418295 13:110148890-110148912 GATTTATAGTGACTACAACAAGG - Intergenic
1113512604 13:110867994-110868016 GTTTTTTTGGGACTAAACTATGG - Intergenic
1113576857 13:111401168-111401190 ATTTTCTTTTTACTAAAAAAAGG - Intergenic
1113744767 13:112736252-112736274 GTTTGCTTGTCTCTAAAACGGGG + Intronic
1113753944 13:112795839-112795861 GTTTTCTTGTGTATACAACTTGG - Intronic
1115616657 14:35101874-35101896 GTTTTCTTTTTACTTTAACATGG + Intronic
1115732920 14:36290950-36290972 GTGTTATTGTGATTAAAAAAAGG - Intergenic
1115890448 14:38021549-38021571 GTTTTCTTGTCTCTAAAATGTGG + Intronic
1116984662 14:51205904-51205926 TTTTTTTTCTGTCTAAAACAAGG - Intergenic
1116995308 14:51317741-51317763 GTTTTGTTTTGTATAAAACAGGG - Intergenic
1117267789 14:54108116-54108138 GTTTTCTTATGACTAAAATGGGG - Intergenic
1117494409 14:56288366-56288388 TTTTCCTTGTGAATAAAATACGG + Intronic
1118047046 14:61981632-61981654 GTTTTCTTGCAACTTAGACACGG + Intergenic
1118061474 14:62142723-62142745 GTTTTCTCGTCTCTAAAACAGGG + Intergenic
1118184830 14:63527608-63527630 GTTTTCTTCTCTCTAAAACTGGG - Intronic
1118630440 14:67697597-67697619 GTTTTCTTGTCTGTAAAATAGGG - Intergenic
1121148413 14:91606851-91606873 ATTTTCTTGTGAGTTAAATAGGG - Intronic
1122726526 14:103758413-103758435 GTTTTCTTATCTGTAAAACAGGG - Intronic
1124958910 15:34380459-34380481 GTAGTCATGTGATTAAAACAGGG + Intronic
1124975538 15:34526680-34526702 GTAGTCATGTGATTAAAACAGGG + Exonic
1125362016 15:38874398-38874420 GGTGTATTTTGACTAAAACAGGG + Intergenic
1125486609 15:40115650-40115672 GTTTTCTTAAGTGTAAAACACGG - Intergenic
1125795280 15:42399770-42399792 GTTTCCTTCTCAGTAAAACAGGG - Intronic
1126474868 15:49054922-49054944 GTTTTCCTGCAACTAAACCAGGG + Intergenic
1126881460 15:53102997-53103019 GTTTTCTTGGGTTTAAAAAAGGG - Intergenic
1128014974 15:64336272-64336294 ATTTTCTTGTGAATAGAATAAGG - Intronic
1129620756 15:77143186-77143208 GTTGTCTTGTAAATAAACCATGG - Intronic
1130259135 15:82341764-82341786 GTAGTCATGTGATTAAAACAGGG + Intronic
1130269537 15:82437350-82437372 GTAGTCATGTGATTAAAACAGGG - Intronic
1130282131 15:82527385-82527407 GTAGTCATGTGATTAAAACAGGG - Intergenic
1130473500 15:84243580-84243602 GTAGTCATGTGATTAAAACAGGG - Exonic
1130480914 15:84357644-84357666 GTAGTCATGTGATTAAAACAGGG - Intergenic
1130490798 15:84430115-84430137 GTAGTCATGTGATTAAAACAGGG + Intergenic
1130502385 15:84508883-84508905 GTAGTCATGTGATTAAAACAGGG + Intergenic
1130595779 15:85248186-85248208 GTAGTCATGTGATTAAAACAGGG - Intergenic
1130618019 15:85431393-85431415 GTTTTCTCATGTGTAAAACAAGG + Intronic
1130690672 15:86079300-86079322 GTTTTCTTATTTGTAAAACAGGG + Intergenic
1131405762 15:92163127-92163149 GTTTTATAGTGACTAAAGGAGGG + Exonic
1132319515 15:100915301-100915323 GTTTTCTTGTTTTTAAAAAAAGG + Exonic
1133912593 16:10079386-10079408 GTTTTCCTCTGCCTGAAACATGG - Intronic
1135066917 16:19317721-19317743 TTTTTGTTGAGACAAAAACAAGG - Intronic
1136014572 16:27387407-27387429 GTTTTCTTATGTCTAAAATGGGG + Intergenic
1137814650 16:51386976-51386998 GTTTTCTTGTCATGAAAAGAAGG + Intergenic
1138012222 16:53392957-53392979 GCTTTCTTCTGAAAAAAACAAGG - Intergenic
1138109193 16:54309760-54309782 GTTTCCTTGTGAGTAAAACAAGG + Intergenic
1138112804 16:54337940-54337962 GTTTTCTTATCACTAAAATGGGG + Intergenic
1138322744 16:56131154-56131176 TTCTTCTTTTGAATAAAACAAGG - Intergenic
1138895164 16:61195549-61195571 TTTTGCTAGTGACTAAAACTTGG - Intergenic
1138987766 16:62351442-62351464 GTTTGTTTATGACTAAAACTAGG - Intergenic
1139000214 16:62500640-62500662 CATTTCTAGTGACTCAAACAAGG - Intergenic
1140118237 16:72061266-72061288 GTTTCCTTGTCTGTAAAACAAGG - Intronic
1140120270 16:72077457-72077479 GTTTCCTTGTCTGTAAAACAAGG - Intronic
1140201652 16:72899718-72899740 GTTTCCTTGTGTGCAAAACAGGG + Intronic
1140429427 16:74889048-74889070 GTTTCCTTGTCACTAACACAGGG - Intronic
1141372222 16:83498532-83498554 GTTTTCTAGGGACTGACACATGG - Intronic
1141374991 16:83522529-83522551 GTTTTCCTGTAACTCAAAAATGG - Intronic
1141471334 16:84240536-84240558 ATTGTCTTGTCTCTAAAACATGG + Intergenic
1142841590 17:2635760-2635782 GTTTTTTTCTGATTAAAGCAGGG + Intronic
1143861788 17:9896723-9896745 TTTTCCTTGTCTCTAAAACAAGG + Exonic
1143922213 17:10339004-10339026 GCTTTCTTGTCCATAAAACAAGG - Intronic
1144774867 17:17780371-17780393 GTTTTCTTGGGAGAAAAAAAGGG - Intronic
1145749036 17:27342051-27342073 GTTTTCTTGTTACTTCAACGTGG + Intergenic
1146478353 17:33181237-33181259 GTTTTGTTGTGTGTAAAATAAGG + Intronic
1146641277 17:34543492-34543514 ATTTTAATGTGACTAAAATAAGG - Intergenic
1146703473 17:34981572-34981594 GTTTTCTTATTTCTAAAGCAGGG - Intronic
1147653807 17:42077247-42077269 GTTTCCTTATCTCTAAAACAGGG + Intergenic
1148142071 17:45336137-45336159 GTTTCCTTGTCTGTAAAACAGGG + Intergenic
1148833050 17:50448462-50448484 GTTTTGCTGTGACAAGAACATGG - Intronic
1149152929 17:53591800-53591822 GTTTTCATGTGTGTAAGACACGG + Intergenic
1149326352 17:55534355-55534377 GGTGTTATGTGACTAAAACATGG + Intergenic
1149539523 17:57458476-57458498 CTTTCCTTCTGACTAAAGCATGG - Intronic
1149571840 17:57677591-57677613 GTTTTCTTTTCACTAAAAGATGG - Intronic
1150322520 17:64227573-64227595 GTTTTCTTGTGGGTAAGGCACGG - Intronic
1150343678 17:64388029-64388051 GTTTCCTTGAGTGTAAAACAAGG + Intronic
1151068180 17:71176481-71176503 GTTTTCTTTTGACTGTATCACGG + Intergenic
1152143807 17:78555345-78555367 GTGTGCTCGTGACTAAATCATGG + Intronic
1153156940 18:2160596-2160618 GTTTTCTTGGAAGTAAAACAAGG - Intergenic
1153287715 18:3471759-3471781 GTTTTATTTTTACTAGAACAGGG + Intergenic
1155283580 18:24265980-24266002 ATTTTCGTGAGAATAAAACATGG + Intronic
1155772431 18:29718997-29719019 TTTTTCTTGTTACCAAAATAAGG + Intergenic
1158073515 18:53501272-53501294 GTTTCCTTGTGCCTAAAATGGGG - Intronic
1158255821 18:55547363-55547385 GTTTTATTGTAAATATAACATGG - Intronic
1159194418 18:65094093-65094115 GTTGTCTTGTGTCTATGACAAGG + Intergenic
1164134739 19:22404294-22404316 GTTTTCTTGGACCAAAAACATGG - Intronic
1164164072 19:22652500-22652522 GTTTTCTTGGACCAAAAACATGG + Intronic
1165089987 19:33380961-33380983 TTTTTGTTGAGACTAAAAAATGG + Exonic
1166602086 19:44105176-44105198 GTTTGCTTGAGAGTAAAACTAGG - Intronic
1167632456 19:50633802-50633824 GTTTTCTTTTGTGGAAAACAGGG - Intronic
1168284847 19:55325909-55325931 GTTTTCTTGTCTGCAAAACAGGG + Intronic
926994474 2:18719279-18719301 GTTTTCCTATGCCTCAAACAAGG + Intergenic
927279368 2:21290420-21290442 ATTTTGTTGTGAGTAAAAAACGG + Intergenic
928057699 2:28074551-28074573 GTATGTTTGTGAATAAAACAGGG + Intronic
928094727 2:28397136-28397158 GTTTTCTTCTAAATAAAACCTGG + Intronic
930305590 2:49670619-49670641 TTTTTCTTGTGGCTAAAACTTGG + Intergenic
932162173 2:69470713-69470735 TTCTCCTTGAGACTAAAACAGGG + Exonic
932926836 2:75986003-75986025 GTTTTCTTATTAGTAAAACGTGG + Intergenic
933448602 2:82415735-82415757 CTTTTACTGTGAGTAAAACAAGG + Intergenic
936226057 2:110653464-110653486 GGATTCTTGTGAGGAAAACATGG - Exonic
936505250 2:113100410-113100432 CTTCTCTTGTGACTAGCACAAGG - Intergenic
936692552 2:114909222-114909244 GTTTTCTAATGATTAACACATGG + Intronic
937779876 2:125824943-125824965 GTTTTCTTGTTTCTTAATCATGG + Intergenic
939271874 2:139949525-139949547 ATTTTCTTGCAACTAAAACATGG + Intergenic
939630885 2:144524597-144524619 GTTTTCTGGTGACTCCTACAGGG - Intergenic
940110927 2:150153040-150153062 ATTTTCTTGGGACTACAAAATGG + Intergenic
941311045 2:163932060-163932082 GTTTTCTTGGCTCTAAAACAAGG + Intergenic
941628356 2:167855706-167855728 GGTTTCATGTGTTTAAAACAAGG + Intergenic
943555088 2:189393351-189393373 GTTTTCCAGTGACTACAAAATGG - Intergenic
943617054 2:190104781-190104803 GTTTTGTTGTGTCTGAGACAGGG - Intronic
944362477 2:198874024-198874046 GTTTTCTTGTGAATATGACTTGG - Intergenic
944435893 2:199689206-199689228 GTTCTCTTATGAATAAAGCAAGG + Intergenic
944920363 2:204406464-204406486 GATTTCAGATGACTAAAACAGGG - Intergenic
945415912 2:209572613-209572635 GTTTTGTTATGATTAAAAAATGG - Intronic
946010007 2:216557143-216557165 GTTTCCTTGTCAATAGAACAGGG - Intronic
946676007 2:222160314-222160336 GTTTTCTGGTCATAAAAACAGGG + Intergenic
947061884 2:226176177-226176199 GTTTTCTTATATATAAAACAGGG - Intergenic
947631565 2:231656747-231656769 GTTTTCTCCTCTCTAAAACAAGG + Intergenic
1169412387 20:5382788-5382810 GTTTTCTTGTGGCTATAATAAGG - Intergenic
1169778730 20:9285314-9285336 GGTTTCATGTGACTAATACTGGG + Intronic
1169818599 20:9684803-9684825 GTTTTCTTAAGACTAAAAGCTGG + Intronic
1171854600 20:30332989-30333011 GTTTTCTTGTCTGTAAAACGGGG - Intergenic
1172950701 20:38721879-38721901 GTTTTCTTGTCTGTAAAACTAGG + Intergenic
1173533758 20:43792358-43792380 GATGACTTGTGACTAAGACACGG + Intergenic
1174058737 20:47817410-47817432 GCCTCCTTGTGACCAAAACATGG + Intergenic
1174159561 20:48541267-48541289 GCCTCCTTGTGACAAAAACATGG - Intergenic
1174336485 20:49865158-49865180 GTTTTCTCATCAGTAAAACAGGG - Intronic
1174856594 20:54051287-54051309 GTTTGCATGTGAACAAAACAGGG + Intronic
1175232578 20:57483105-57483127 GTTTCCTTCTAACTAAAAAAAGG - Intergenic
1175365544 20:58452658-58452680 CTTTTCCTGTTAGTAAAACAAGG - Intergenic
1175978010 20:62723157-62723179 GTTTTCTTATAATTCAAACACGG + Intronic
1176828504 21:13721416-13721438 GTTTTCCTGGTACTAAAGCAAGG + Intergenic
1178600345 21:33988982-33989004 GTTTTCTTGTCAGCAAAACTGGG + Intergenic
1178617794 21:34148544-34148566 GTTTTCTTGTGATTAAAGACAGG - Intergenic
1178721630 21:35015789-35015811 GTTTTGTTGTCTGTAAAACAGGG - Intronic
1178816739 21:35937155-35937177 GTTTTCTTGTGATTAGACCAGGG - Intronic
1180720985 22:17908260-17908282 GTTTCCTTGTGTGTAAGACAAGG + Intronic
1181723196 22:24792107-24792129 ATTTTCTTATCAGTAAAACAAGG - Intergenic
1182561240 22:31160763-31160785 GTTTTCTCGTCTCTAAAACGGGG + Intronic
949474345 3:4429364-4429386 CTTTTCCAGTGTCTAAAACAGGG + Intronic
949615563 3:5750206-5750228 CTTTTCTTTTGACTTAAACATGG + Intergenic
950411335 3:12839840-12839862 GTTTTCTTGTCTATAAAATAGGG + Intronic
951864822 3:27296319-27296341 GTTTTCTCATGTATAAAACAAGG - Intronic
952289877 3:32004800-32004822 CTTTTCTTTGGTCTAAAACATGG - Intronic
952685870 3:36147893-36147915 GTTTTCTTGGGAACACAACAGGG + Intergenic
952763970 3:36939342-36939364 GTGGTCATGTGGCTAAAACATGG - Intronic
954792893 3:53146105-53146127 GTTTTCTTGTCTATAAAATAAGG - Intergenic
955654952 3:61235307-61235329 GTTTTCTCGTGTGTAAAACAAGG + Intronic
957268094 3:77994000-77994022 GTTTCCTTGGAAGTAAAACAAGG - Intergenic
957429014 3:80077389-80077411 GTTCTCATGTCACTAAACCAGGG + Intergenic
958713959 3:97755008-97755030 GTTTTCTTTTAAACAAAACATGG + Intergenic
958796854 3:98715317-98715339 TTTTTCTCTTGAGTAAAACATGG - Intergenic
958844639 3:99251730-99251752 ATATTCTTGCAACTAAAACAAGG - Intergenic
958903684 3:99918276-99918298 GTTTTCTGGTATATAAAACAAGG - Intronic
959067132 3:101669037-101669059 TTTTTTTTGTGGCTAAGACAGGG + Intronic
959679057 3:109072024-109072046 GTTTATTTGTGACAAAAAGAAGG + Intronic
960280304 3:115774245-115774267 GTTTTCTCATGCTTAAAACAGGG - Intergenic
960656876 3:120014435-120014457 TTATTCTTGTGATTAAAATAGGG + Intronic
961322911 3:126090638-126090660 GTTTCCTTGGAAGTAAAACAAGG - Intronic
961794033 3:129396731-129396753 GTTTTCTTGTCTATAAAATAGGG + Intergenic
962055932 3:131871679-131871701 GTTTTCTTGTGGAAAAAATAAGG + Intronic
962228170 3:133633782-133633804 GTTTTGTTGTGTTTAAGACAAGG - Intronic
962485850 3:135841470-135841492 GTTTAGTTCTGACTAAAACAGGG - Intergenic
963090773 3:141481748-141481770 GTTTTCTTGTGACACAGAAAGGG - Intergenic
963107029 3:141656228-141656250 GGCTTCTAGTGAATAAAACATGG - Intergenic
963574256 3:147040015-147040037 TTTTTCTTGTAAATAAAAGAGGG + Intergenic
963728171 3:148945277-148945299 TTTTTCTTGTGTGTATAACATGG - Intergenic
964869412 3:161296921-161296943 ACTTTCTCGTGAGTAAAACAGGG - Intergenic
966770235 3:183497659-183497681 TTTTTCTTGTCCCTAAATCAAGG + Intronic
967473061 3:189885436-189885458 GTTTTCTTGTGAGAAAACAAAGG + Intronic
967678089 3:192324563-192324585 GTTTTCTTATGTGTAAAACAGGG - Intronic
967900546 3:194446628-194446650 GATTTTTTGTGACCAAAATATGG + Intronic
969676588 4:8617763-8617785 GTTTTCTGCTGACTAGAGCAGGG + Intronic
970018810 4:11543488-11543510 GTTTTCATCTCAGTAAAACAAGG - Intergenic
971120731 4:23701774-23701796 GTTTCCTTGTGACTAATGAATGG - Intergenic
971397058 4:26238392-26238414 GCTTTCTTGTCTGTAAAACAAGG + Intronic
971477565 4:27086629-27086651 GTTTTCTTGTCTCTAAAATGGGG + Intergenic
971821166 4:31557102-31557124 GTTTTCTTATATCTAAAATAAGG - Intergenic
973340328 4:48996748-48996770 TTCTTCTTGTGAGTAAAGCAAGG - Intronic
973755710 4:54071447-54071469 GTTTTATAATGTCTAAAACAGGG - Intronic
974230537 4:59108415-59108437 GTTTTCTTGTGAATACACTAGGG + Intergenic
974643184 4:64659546-64659568 GTTTTATTGTGACACAAAAAAGG + Intergenic
975224601 4:71857062-71857084 GTTTCCTTGGAAGTAAAACAAGG + Intergenic
975809153 4:78147664-78147686 GTTTTCTTATGTTTAAAACTAGG + Intronic
976489808 4:85657058-85657080 ATTTTCTATTGACTGAAACAAGG + Intronic
976548865 4:86371422-86371444 GTTTTCTTGTATATAAAATAAGG - Intronic
976749492 4:88439718-88439740 GTTGTATTGTGACCAAAACCTGG - Intronic
977373901 4:96175484-96175506 GTTTTATTTAAACTAAAACAGGG - Intergenic
977807828 4:101323799-101323821 ATTTTCTTGTCATTAAAACACGG - Intronic
979102297 4:116634178-116634200 ATTTTCTTGTCATTAAAACAGGG - Intergenic
979304899 4:119131295-119131317 GTTTTCTTATCTGTAAAACAGGG + Intergenic
979366848 4:119835664-119835686 GCTTTCTTGTTAAGAAAACAAGG - Intergenic
979408726 4:120346754-120346776 ATTTTCTTGTTAGTAAAAAATGG + Intergenic
979977196 4:127211484-127211506 GTTTTCTCATCACTAAAACAAGG - Intergenic
980000820 4:127485660-127485682 GTTTTCTTTTAAAAAAAACATGG + Intergenic
981566201 4:146104398-146104420 GTCTTCTGGTGAGAAAAACATGG + Intergenic
982073991 4:151720368-151720390 GTTTCCTTGTGTCTAAAAGTGGG + Intronic
982240930 4:153298738-153298760 CTTTTCTTGTTATTGAAACAGGG + Intronic
983746789 4:171211111-171211133 GTTTTCTTATGGATTAAACATGG + Intergenic
985165771 4:187092520-187092542 ATTTTCTTATCAGTAAAACAGGG + Intergenic
985251223 4:188026479-188026501 GTTTTCCTGTGATAAAAACATGG + Intergenic
986517189 5:8576034-8576056 GTTTTCTAATGAATAAATCATGG + Intergenic
986630465 5:9767457-9767479 GTTTTCTCATCAGTAAAACAGGG + Intergenic
987056681 5:14200011-14200033 GTTTTCTAGTGACTATACTAGGG + Intronic
987356224 5:17065533-17065555 GTTTCCTTGGAAGTAAAACAAGG - Intergenic
987367182 5:17159322-17159344 GTTTTCTTGTTTCTGAGACAGGG + Intronic
990136332 5:52648758-52648780 GTTTTCTTGATACTGTAACAGGG - Intergenic
990185816 5:53207805-53207827 GTTTCCTTGGAAGTAAAACAAGG + Intergenic
992171120 5:74103149-74103171 GTTTTTTTGTTACTTAAGCATGG - Intergenic
992255360 5:74915522-74915544 GATTTGCTGAGACTAAAACAGGG - Intergenic
993549579 5:89257065-89257087 GTTTTCTTGTCAGTAAAATGGGG + Intergenic
993992227 5:94672711-94672733 GTTTTCTTTTGTCTTTAACATGG + Intronic
994056528 5:95422769-95422791 TTTGTCTTGTAAATAAAACAGGG - Intronic
994674680 5:102805466-102805488 GTTTTTTTCTGAATAAAAGAAGG + Intronic
994971952 5:106750774-106750796 GTTTTCTTGTTGGTAAAATAGGG - Intergenic
995382517 5:111550529-111550551 GTTTTCTTGTGACCAAGGTATGG - Intergenic
995608659 5:113886260-113886282 GTCTTCTTTTGAATAAAATAAGG + Intergenic
995904291 5:117105034-117105056 GTTCTTTTGTGTCTAAAAAATGG + Intergenic
996636711 5:125699094-125699116 ATTTTCTTGTCTATAAAACAGGG + Intergenic
997766115 5:136505399-136505421 GCTTTCTTGTTTGTAAAACAAGG + Intergenic
999766582 5:154745529-154745551 GTTTTCTTGTGTGTAAAATGGGG - Intronic
1001833210 5:174807001-174807023 GTTTTCTTGTGTGTAAAATGGGG + Intergenic
1002071863 5:176683503-176683525 GTTTTCTTGCCTGTAAAACAGGG - Intergenic
1002088385 5:176790248-176790270 ATTTTCTTGTAACTAAAACGGGG + Intergenic
1002291137 5:178201691-178201713 GTATTCTTGTGTATAAAATATGG + Intergenic
1004527113 6:16419504-16419526 GTTTTCTTGTGATACAACCATGG + Intronic
1004636192 6:17470287-17470309 GTTTTCTTGTCTTTAAAATAGGG + Intronic
1004878123 6:19976815-19976837 GATTTCTTTTGACTTAAACTGGG - Intergenic
1006935262 6:37712760-37712782 GTTTGCTTGTCTGTAAAACAAGG + Intergenic
1007021067 6:38522037-38522059 GTTGTCTTGTGCCTAGGACAGGG - Intronic
1008692632 6:53997993-53998015 TTTTCCTTGTGATTAGAACATGG + Intronic
1009318044 6:62248108-62248130 TTTATCTTGTGACTACAACTAGG - Intronic
1010736442 6:79449325-79449347 GTTTTCTGGTGAGTAAACAAAGG + Intergenic
1010739491 6:79483240-79483262 GTTTTCTTCTTTATAAAACAGGG - Intergenic
1010832361 6:80546337-80546359 GGTTTCCTATGATTAAAACATGG - Intergenic
1011933924 6:92751295-92751317 CTTTTTTTGTGGCTAACACATGG + Intergenic
1012431821 6:99172016-99172038 GTTTTCTTCTGACTCAAAGGAGG - Intergenic
1012661886 6:101908891-101908913 GTTATCTTATGTATAAAACAAGG - Intronic
1012848052 6:104414387-104414409 GTTTTCTTCTGTCTATAAAATGG + Intergenic
1012942626 6:105431445-105431467 CTTTTCTTGTCACTAAAAATTGG - Intergenic
1014626981 6:123738344-123738366 TTTTTCTTGTGATTAGAACGTGG + Intergenic
1015017555 6:128432575-128432597 TTTATCTTGGGACTGAAACAGGG - Intronic
1015417677 6:132968315-132968337 GTTTGCCTGTGAATAAAACAAGG + Intergenic
1015716152 6:136194235-136194257 GGTTTCTTGGGACTAAAAAATGG + Exonic
1016268866 6:142264617-142264639 GTTTTCTTGCCACTAAAACATGG - Intergenic
1016409498 6:143767190-143767212 GTTTTCTTATCTATAAAACAGGG - Intronic
1018441505 6:163817791-163817813 ATTTATTTGTGAGTAAAACAGGG + Intergenic
1018739942 6:166720776-166720798 GTTTCCTTCTGAGTAAAATAAGG - Intronic
1020634766 7:10684150-10684172 GTTTTCTTGTGATGAGATCAGGG - Intergenic
1020804207 7:12768353-12768375 GTTTCCTTATGGGTAAAACAGGG + Intergenic
1020901285 7:14006699-14006721 GGCTTCTTGTGAACAAAACAAGG + Intergenic
1021493608 7:21247580-21247602 GTTTTCCTGTTACTAAAATGGGG + Intergenic
1021544867 7:21802035-21802057 GTTTTCTTGTATCTAAAACAGGG + Intronic
1021718539 7:23484249-23484271 GTTTTCTTGTCACCAAAAATAGG - Intergenic
1022004888 7:26258319-26258341 GTTTCCTTGGAAGTAAAACAAGG + Intergenic
1022678863 7:32525770-32525792 GTTTCCTTGAAAGTAAAACAAGG - Intronic
1022980566 7:35601471-35601493 TTTTTCTTCTGACTGAAACTTGG + Intergenic
1023037201 7:36142380-36142402 GTTTTCTGGTGAATAAAATGAGG + Intergenic
1023093409 7:36637321-36637343 GTTTTCTTGTCTGTAAGACAAGG - Intronic
1023116834 7:36871059-36871081 GTTTTGTTGTCTGTAAAACAGGG - Intronic
1023412286 7:39900167-39900189 GTTTTCTTGTGAACAAAATCTGG - Intergenic
1025115545 7:56254977-56254999 CTTTTGATGTGACTTAAACAAGG - Intergenic
1026199934 7:68205868-68205890 CTTTTGATGTGACTTAAACAAGG - Intergenic
1027363081 7:77429471-77429493 GTTTGCTTATGACCAAAAAAAGG - Intergenic
1027556215 7:79668013-79668035 GTTTTCTTTTGGCTGAAATAAGG + Intergenic
1027664563 7:81028841-81028863 GTTTTCTGATGAATAAAACTTGG + Intergenic
1028037115 7:85998907-85998929 GTTTTCTTGTGAGGAAATTAGGG - Intergenic
1028110895 7:86939846-86939868 GATTTCTTGGGAGTAAAACCAGG + Intronic
1028525152 7:91775857-91775879 GTTTTATTCTGCCTGAAACATGG - Intronic
1028614333 7:92748573-92748595 GTTTTCTTATCCATAAAACAAGG - Intronic
1030374161 7:108736036-108736058 GTTATTCAGTGACTAAAACAAGG - Intergenic
1031424640 7:121590715-121590737 GTTTTCTGGTGTGTAAAACAAGG - Intergenic
1032463379 7:132127831-132127853 TTTTTCTTATAACAAAAACATGG + Exonic
1033781131 7:144670416-144670438 TTTTTCTTGTTCCTAACACATGG + Intronic
1034107499 7:148502723-148502745 GTTTCCTTAAGAATAAAACAGGG - Intergenic
1034788807 7:153949398-153949420 CTTTTCTTATGACTCAATCAAGG + Intronic
1034895702 7:154875188-154875210 GTTTTCTTTTTCCTCAAACAGGG - Intronic
1035057978 7:156049638-156049660 GTCTCCTTGTCAGTAAAACAGGG + Intergenic
1035912671 8:3584948-3584970 GTTGTCTAGTGACAAAAAGAAGG + Intronic
1036034145 8:5000753-5000775 GTTTTCTTATCTGTAAAACAAGG + Intergenic
1036295410 8:7530896-7530918 GTTTCCTTGGAAGTAAAACAAGG + Intergenic
1036327159 8:7790123-7790145 GTTTCCTTGGAAGTAAAACAAGG - Intergenic
1036490037 8:9216388-9216410 GTTTTCTTATTTGTAAAACAGGG + Intergenic
1036695691 8:10973501-10973523 GTTTTCTTATGTATAAAACGGGG - Intronic
1036826524 8:11980681-11980703 GCATTCTTGTGAATAAAACAGGG + Intergenic
1037029123 8:14080260-14080282 GTTTTCTTGTCTATAAAACTTGG + Intergenic
1038191107 8:25321905-25321927 GTTTTCTTGCTACTGCAACATGG - Intronic
1038263276 8:26016718-26016740 GTTTTCTTGAGATCAAAAGAAGG - Intronic
1038373354 8:27013635-27013657 GTTTTCTTATGCCCAAAAGAGGG + Intergenic
1038753947 8:30323472-30323494 GTTTTTTTCTGACAAAAAAAAGG + Intergenic
1038873660 8:31523525-31523547 GTTTCCTTTTGAGGAAAACAAGG - Intergenic
1042894171 8:73648436-73648458 GTTTCTTCGTAACTAAAACAGGG + Intronic
1043948037 8:86276151-86276173 GTTTCCTTGGAAGTAAAACAAGG + Intronic
1046397898 8:113664750-113664772 GTTTTTATGTGACAGAAACAAGG + Intergenic
1046428881 8:114095434-114095456 GTTTTCCTGTGTCTGGAACAGGG + Intergenic
1047023803 8:120805946-120805968 GTTTTCTTGTCTGTAAAATAGGG + Intronic
1047333773 8:123917112-123917134 GTTTTCTTGTCTGTAAAAGAGGG + Intronic
1050876416 9:10643071-10643093 GTTTTCTTCTGTATAAAAGAGGG - Intergenic
1050982067 9:12032426-12032448 GTTTTCTAGTGTCTGAAAGAGGG + Intergenic
1051304558 9:15694920-15694942 GTTTTCTTGTCTCTAAAATTGGG + Intronic
1051860485 9:21619498-21619520 GTTTTCTTGTGTATAAAGGAGGG + Intergenic
1054711539 9:68516055-68516077 GTTTTCTTATTTGTAAAACATGG - Intronic
1055212109 9:73808748-73808770 GTTTTCTTATGTCTAAAATGGGG - Intergenic
1055213254 9:73825004-73825026 GTCTTCTTGTGATTAAATCCAGG - Intergenic
1056049196 9:82750403-82750425 GTTTTCTAGAGAAGAAAACATGG + Intergenic
1057644163 9:96857292-96857314 TCATTCTTGTGACTAAAACTGGG + Intronic
1058352428 9:104041658-104041680 GTTTCCTTGAAAGTAAAACAAGG + Intergenic
1058726281 9:107807778-107807800 GTTTACTTGTTACTACAGCATGG + Intergenic
1059014838 9:110504601-110504623 TTTTTCTTTTAACTAAAACAAGG - Intronic
1059100416 9:111466079-111466101 TTTTTCTTGTCTTTAAAACATGG - Intronic
1059988048 9:119838846-119838868 GTTTTCTTATCTGTAAAACATGG + Intergenic
1060155317 9:121315892-121315914 GTTTCCTTGTGAATGAGACAGGG + Intronic
1060675539 9:125511020-125511042 GTTTTCTTCTTTATAAAACAGGG + Intronic
1061369493 9:130190441-130190463 GTTTTCTGGTGAGAAAACCAAGG + Intronic
1186603755 X:11067033-11067055 GTTTTCTTGGGACTATATTAAGG + Intergenic
1187172760 X:16868377-16868399 GTTTCCTTATCAGTAAAACAAGG + Intronic
1187659145 X:21519065-21519087 ATTTTCTAGTGGCTAAAACAAGG + Intronic
1188526211 X:31090636-31090658 GCTTTGTAATGACTAAAACACGG + Intergenic
1188694656 X:33175722-33175744 GTTTTCTGATTAGTAAAACAGGG + Intronic
1188876313 X:35434527-35434549 GTTTCCTTGGAATTAAAACAAGG + Intergenic
1189519973 X:41756739-41756761 GTTTTCTCGTAAGTAAAATAGGG - Intronic
1190570489 X:51776930-51776952 GTTTCCTTGGAAGTAAAACAAGG - Intergenic
1190775054 X:53545929-53545951 GCTTTCTTCTCAGTAAAACAGGG + Intronic
1191624877 X:63259813-63259835 GTTTCCTTGGAAGTAAAACAAGG + Intergenic
1192306186 X:69962336-69962358 GTTTTCTTGTCCTTAAAACAGGG + Intronic
1193709125 X:84857926-84857948 GTTTCCTTGGAAGTAAAACAAGG + Intergenic
1193716596 X:84941448-84941470 GTTTCCTTGGAAGTAAAACAAGG + Intergenic
1194485511 X:94480992-94481014 TTTTTCTTTTGACTAAAAAAGGG + Intergenic
1194514370 X:94832805-94832827 GTGTTCTTGCCACTAAAATAAGG + Intergenic
1195546538 X:106118209-106118231 GTTTCCTTGGAAGTAAAACAAGG + Intergenic
1195675617 X:107505257-107505279 GTTTTCTTGTTGGTCAAACAGGG - Intergenic
1195991297 X:110685160-110685182 ATTTTCTTGTGACTGAATTATGG - Intronic
1196290830 X:113939090-113939112 GTTTTCTTATTTGTAAAACAGGG - Intergenic
1196352894 X:114754008-114754030 TTCTTCTTGTGACTTACACATGG + Intronic
1196583885 X:117407738-117407760 GTTTTCTTATCTGTAAAACAAGG + Intergenic
1196593616 X:117517819-117517841 AATTTCTTGTGACTATAATATGG + Intergenic
1197605265 X:128578254-128578276 GTCTTCTTGTTAGTAAAAGAAGG - Intergenic
1198032811 X:132770201-132770223 GTTTTCTCATGTGTAAAACAGGG - Intronic
1198434131 X:136598760-136598782 TTTTTCTTGTGACTGGAACCTGG + Intergenic
1198880869 X:141279775-141279797 GTTTCCTTATGAGTAAAACTGGG - Intergenic
1198887457 X:141354972-141354994 GATTTCATGTGCCTAATACAAGG - Intergenic
1199040519 X:143110544-143110566 TTTTGCCAGTGACTAAAACAAGG - Intergenic
1199474856 X:148233656-148233678 GTTTTCTTATCAACAAAACAAGG + Intergenic
1202367439 Y:24175447-24175469 GTAGTCATGTGATTAAAACAGGG - Intergenic
1202503344 Y:25494676-25494698 GTAGTCATGTGATTAAAACAGGG + Intergenic