ID: 1086573823

View in Genome Browser
Species Human (GRCh38)
Location 11:88315214-88315236
Sequence CCTCAAACAGCAGAGGTGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 742
Summary {0: 1, 1: 0, 2: 1, 3: 47, 4: 693}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086573823 Original CRISPR CCTCAAACAGCAGAGGTGGG AGG (reversed) Intronic
900275087 1:1820111-1820133 CCTCAGGCGGCTGAGGTGGGTGG + Intronic
900410723 1:2511302-2511324 TCCCCAGCAGCAGAGGTGGGAGG + Intronic
901336673 1:8455111-8455133 CCTCAGACAGCAGAGCCAGGAGG + Intronic
901541539 1:9920841-9920863 ACTCACAAAGCTGAGGTGGGAGG - Intergenic
901819933 1:11822365-11822387 ACTCAAGAAGCTGAGGTGGGAGG - Intronic
903093301 1:20943052-20943074 ACTCAAAAGGCTGAGGTGGGAGG + Intronic
903112080 1:21144360-21144382 GCTCAAAGAGCTGAGGTGGGAGG - Intronic
903175861 1:21580176-21580198 CTTCGAAAAGCTGAGGTGGGAGG + Intergenic
903848522 1:26292408-26292430 ACTCAGACAGCTGAGGTGGGAGG + Intronic
904096409 1:27981667-27981689 ACTCGAAAAGCTGAGGTGGGAGG + Intronic
904152333 1:28452395-28452417 ACTCAGACAGCTGAGGTGGGAGG + Intronic
904256715 1:29259251-29259273 CCTCAAACAGCACCTGGGGGAGG - Exonic
904368694 1:30034902-30034924 CCACACATAGCAGGGGTGGGTGG - Intergenic
904513994 1:31039103-31039125 ACTCAGGCAGCTGAGGTGGGAGG - Intronic
905426465 1:37889126-37889148 ACTCCAGCAGCTGAGGTGGGAGG + Intronic
905743545 1:40393215-40393237 ACTCAAGAAGCTGAGGTGGGAGG + Intronic
905745609 1:40414881-40414903 CCTCAATCAGCAGAAGCGGATGG - Intronic
905793947 1:40804878-40804900 ACTCAGGCAGCTGAGGTGGGAGG + Intronic
906202548 1:43969548-43969570 ACTCAAGAGGCAGAGGTGGGAGG + Intergenic
906660420 1:47577901-47577923 CCTCACACAGGAGAGCTGGTAGG + Intergenic
906679993 1:47720015-47720037 GCTCAGGCTGCAGAGGTGGGTGG - Intergenic
907506075 1:54919145-54919167 CGGCAAACAGCAGTGGTGGACGG + Intergenic
907602277 1:55783545-55783567 CGGCAAACAGCAGTGGTGGATGG + Intergenic
907980380 1:59474507-59474529 ACTCAAACAGGAGAAGTGGCAGG - Intronic
908223088 1:62028310-62028332 ACTCAAAAGGCTGAGGTGGGAGG - Intronic
908841525 1:68284885-68284907 ACTCAGAAAGCTGAGGTGGGAGG + Intergenic
909568157 1:77078782-77078804 ACTCAAAAGGCTGAGGTGGGGGG + Intergenic
909617025 1:77622196-77622218 ACTCAGGCAGCTGAGGTGGGAGG + Intronic
911097451 1:94066212-94066234 CCTCAAGCAGCATGGTTGGGTGG - Intronic
911375904 1:97051130-97051152 CCTAAAACAGTAGAAGTGAGTGG - Intergenic
911863771 1:102990074-102990096 ACTAAAAAAGCTGAGGTGGGAGG + Intronic
911935976 1:103972663-103972685 GCTCAGAAAGCTGAGGTGGGAGG - Intergenic
914789872 1:150868209-150868231 ACTCAGGAAGCAGAGGTGGGAGG + Intronic
915356704 1:155259468-155259490 CCTCAAGAAGCTGAGGTGGACGG - Intronic
915545514 1:156595071-156595093 GCTCAAGCAGCAGAGGTAAGAGG - Intronic
917259169 1:173148542-173148564 CATCAAACAGCAAAGATGGTGGG + Intergenic
918325676 1:183408267-183408289 ACTGAAACAACAGAGGTGAGTGG - Intronic
919018044 1:192066418-192066440 CCTCGATAAGCTGAGGTGGGAGG - Intergenic
919213349 1:194517752-194517774 CCTCAGGAAGCTGAGGTGGGAGG + Intergenic
919261784 1:195205732-195205754 ACTCAGAAAGCTGAGGTGGGAGG - Intergenic
920627118 1:207613044-207613066 CCTCCCACAGCAGAGGGCGGAGG + Intronic
920639855 1:207741518-207741540 CGGCAAACAGCAGTGGTGGACGG + Intergenic
920649740 1:207827954-207827976 CCTCAAATGGCAGATGTGTGAGG - Intergenic
921754644 1:218840505-218840527 ACTCAGAAAGCTGAGGTGGGAGG + Intergenic
922530836 1:226343854-226343876 ACTCAAAAGGCTGAGGTGGGAGG - Intergenic
922876304 1:228942512-228942534 CGGCAAACAGCAGTGGTGGACGG - Intergenic
922877767 1:228953890-228953912 CGGCAAACAGCAGTGGTGGATGG - Intergenic
922908228 1:229192759-229192781 CCTCACACAGCAGCAGTGGAAGG - Intergenic
923029336 1:230234968-230234990 CTTCAGAAAGCTGAGGTGGGAGG + Intronic
923338291 1:232987998-232988020 CCTCCTGCAGCAGAGGCGGGTGG - Intronic
923883793 1:238132585-238132607 TCTCAACCAGCAAAGGTGAGAGG + Intergenic
924535128 1:244929060-244929082 ACTCAGGCAGCTGAGGTGGGAGG - Intergenic
1062790902 10:305751-305773 ACTTAAAAAGCTGAGGTGGGAGG - Intronic
1063554731 10:7067566-7067588 CCTAAAGAAGCTGAGGTGGGAGG - Intergenic
1063616792 10:7607321-7607343 CATCCAACAGCAGAGTTGAGTGG + Intronic
1064056823 10:12104981-12105003 CCTCAAGAGGCTGAGGTGGGAGG - Intronic
1064123091 10:12636434-12636456 CCTCAGGAAGCTGAGGTGGGAGG - Intronic
1064670194 10:17705957-17705979 TCTCGAAAAGCTGAGGTGGGAGG + Intronic
1064784339 10:18877431-18877453 ACTCAGGCAGCTGAGGTGGGAGG - Intergenic
1065199862 10:23302012-23302034 CGGCAAACAGCAGAGGTGGACGG + Intronic
1065209130 10:23386051-23386073 ACTCAAGAAGCTGAGGTGGGAGG + Intergenic
1065271065 10:24034452-24034474 ACTCAAGAAGCTGAGGTGGGAGG + Intronic
1065410350 10:25420256-25420278 CCTCAGAAAGCTGAGGTGGGAGG - Intronic
1065545628 10:26817526-26817548 ACTCAAGAAGCTGAGGTGGGAGG + Intronic
1065614546 10:27506428-27506450 ACTCAAAAGGCTGAGGTGGGAGG - Intronic
1067308655 10:45091849-45091871 ACTCAGAAAGCTGAGGTGGGAGG + Intergenic
1068009497 10:51430310-51430332 CCTCAAGAGGCAGAGGTGGGAGG + Intronic
1068667043 10:59687849-59687871 GCTCAAAAGGCTGAGGTGGGAGG + Intronic
1068791298 10:61034052-61034074 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1068792074 10:61039517-61039539 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1069824076 10:71244657-71244679 CCTCCAAGAGGAGAGGAGGGAGG + Intronic
1070240782 10:74678030-74678052 ACTCAAGAAGCTGAGGTGGGAGG + Intronic
1070344884 10:75531935-75531957 ACTCAAGAGGCAGAGGTGGGAGG + Intronic
1070604316 10:77888154-77888176 CATCAAAGATGAGAGGTGGGCGG + Intronic
1070610997 10:77932500-77932522 CCTCAAAAAGGAGAAGTGGCTGG + Intergenic
1071059707 10:81555056-81555078 ACTCAGATAGCTGAGGTGGGAGG + Intergenic
1071326730 10:84525734-84525756 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1071331542 10:84565570-84565592 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1071352868 10:84763944-84763966 ACTCAAGAAGCTGAGGTGGGAGG + Intergenic
1073453046 10:103620590-103620612 CTGCAAACAGCAGAGCTGGTCGG - Intronic
1073961496 10:108935365-108935387 ACTCACAAGGCAGAGGTGGGAGG - Intergenic
1074330447 10:112502134-112502156 ACTCAAAATGCCGAGGTGGGAGG - Intronic
1074662832 10:115681808-115681830 TCTCAAAAAGAAGTGGTGGGTGG - Intronic
1074837314 10:117309651-117309673 CCTGAAAAAGTAGAGGTGAGGGG - Intronic
1075327649 10:121547501-121547523 ACTCAAGCAGCTGAGGTGGGAGG - Intronic
1075430730 10:122378490-122378512 CTTCAGAAAGCCGAGGTGGGAGG + Intronic
1076424293 10:130356594-130356616 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1076631817 10:131856253-131856275 CAGCGAACAGCACAGGTGGGTGG + Intergenic
1077251375 11:1562162-1562184 CCTCACCCAGCACTGGTGGGTGG - Intronic
1077449295 11:2626635-2626657 ACTCAAGAAGCCGAGGTGGGAGG - Intronic
1078788105 11:14516311-14516333 ACTCAAAAGGCTGAGGTGGGAGG - Intronic
1079066470 11:17298457-17298479 GCTCAGAAAGCTGAGGTGGGAGG + Intronic
1079421464 11:20293685-20293707 ACTCAGACAGCTAAGGTGGGAGG + Intergenic
1080280657 11:30553063-30553085 ACACAGGCAGCAGAGGTGGGTGG - Intronic
1080333159 11:31165418-31165440 GCTCAAAAAGCTGAGGTGGGAGG - Intronic
1080746185 11:35110735-35110757 CGTGAAACGGCAGGGGTGGGAGG - Intergenic
1081070858 11:38606845-38606867 CAGCAAACAGCAGTGGTGGAAGG - Intergenic
1081849819 11:46267346-46267368 ACTCATATAGCTGAGGTGGGAGG + Intergenic
1081922766 11:46794353-46794375 ACTCAAAAGGCTGAGGTGGGAGG + Intronic
1082068497 11:47919778-47919800 ACTCAAGCAGCTGAGGTGGGAGG + Intergenic
1083411762 11:62498666-62498688 ACTCAGAAAGCTGAGGTGGGAGG + Intronic
1083433746 11:62629000-62629022 CCTCTACCAGCGGATGTGGGTGG - Exonic
1083564947 11:63706296-63706318 ACTCAGAAAGCTGAGGTGGGGGG - Intronic
1084009191 11:66338346-66338368 CCACAAGCCACAGAGGTGGGGGG - Intronic
1084095869 11:66910881-66910903 GCTCAAACTGCAGTGCTGGGAGG - Intronic
1084878722 11:72154300-72154322 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1085110094 11:73880110-73880132 ACTCAAGAGGCAGAGGTGGGAGG + Intronic
1085147734 11:74217431-74217453 ACTCAAGAGGCAGAGGTGGGAGG + Intronic
1085506263 11:77062127-77062149 ACTCAAAAGGCTGAGGTGGGAGG - Intergenic
1085641983 11:78198348-78198370 TCTGTAAAAGCAGAGGTGGGTGG + Intronic
1086573823 11:88315214-88315236 CCTCAAACAGCAGAGGTGGGAGG - Intronic
1087686675 11:101273149-101273171 CAGCAAGCAGAAGAGGTGGGGGG - Intergenic
1087872146 11:103309281-103309303 ACTCAGAAAGCTGAGGTGGGAGG - Intronic
1088242923 11:107789629-107789651 CAGCAAACAGCAGTGGTGGACGG - Intergenic
1088407020 11:109492718-109492740 ACTCAGACAGCTAAGGTGGGAGG + Intergenic
1088459855 11:110071120-110071142 ACTCAGAAAGCTGAGGTGGGAGG - Intergenic
1089732530 11:120528070-120528092 ACTCAAAAGGCTGAGGTGGGAGG - Intronic
1091106349 11:132922963-132922985 CCTCCAAAGGCTGAGGTGGGAGG + Intronic
1091733692 12:2901116-2901138 TCTCAAAAAAAAGAGGTGGGGGG - Intronic
1091749957 12:3016134-3016156 ACTCAAGGAGCTGAGGTGGGAGG - Intronic
1092533256 12:9362765-9362787 ACTCAAAAGGCAGAGGTGGAAGG - Intergenic
1092612223 12:10184580-10184602 CCTCTGACACCAGATGTGGGTGG - Intronic
1092860076 12:12712774-12712796 ACTCAGAAAGCAGAGGTGGGAGG - Intergenic
1092869364 12:12792591-12792613 ACTAAAACCCCAGAGGTGGGAGG + Intronic
1093020116 12:14195511-14195533 ACTCAGAAAGCTGAGGTGGGAGG + Intergenic
1094016789 12:25873403-25873425 ACTCAAAAGGCTGAGGTGGGAGG - Intergenic
1095463533 12:42466983-42467005 ACTCAGAAGGCAGAGGTGGGAGG - Intronic
1095552470 12:43459166-43459188 CAGCAAACAGCAGTGGTAGGCGG - Intronic
1095861393 12:46921962-46921984 GCTACAACAGCAGAGTTGGGTGG - Intergenic
1096351238 12:50902861-50902883 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1096819628 12:54223827-54223849 ACTCAGAGAGCTGAGGTGGGAGG - Intergenic
1097376748 12:58852228-58852250 CAGCAAACAGCAGTGGTGGGCGG + Intergenic
1097377757 12:58859357-58859379 CAGCAAACAGCAGTGGTGGGCGG + Intergenic
1098111545 12:67127122-67127144 ACTCAGAAAGCTGAGGTGGGAGG - Intergenic
1098984869 12:77001448-77001470 CAGCAAACAGCAGTGGTGGACGG - Intergenic
1099901695 12:88718628-88718650 CCTCAGAAAGCTGAGGTGGGAGG - Intergenic
1100330674 12:93579066-93579088 CATCAAACAGCATGGATGGGAGG - Intronic
1100530520 12:95457364-95457386 CCTCAGAAAAGAGAGGTGGGAGG + Intergenic
1100552816 12:95662336-95662358 ACTCAGAAGGCAGAGGTGGGAGG - Intronic
1100752656 12:97716250-97716272 TCTCAAACATCAGAGCTGGAAGG - Intergenic
1101364682 12:104060812-104060834 ACTCCAAAAGCTGAGGTGGGAGG + Intronic
1101901254 12:108792643-108792665 CCGGAAACAGCAGGGGAGGGGGG + Exonic
1102199894 12:111049968-111049990 GGTCCAACAGCATAGGTGGGTGG - Intronic
1102403148 12:112648634-112648656 ACTCAAAAGGCTGAGGTGGGAGG + Intronic
1102734161 12:115143182-115143204 CCTCACACAGCAGAAGGGGCTGG - Intergenic
1103318672 12:120077395-120077417 CCACACACACCAGAGGTGAGGGG - Intronic
1103523414 12:121551264-121551286 CTTAGAAAAGCAGAGGTGGGAGG + Intronic
1103642819 12:122365898-122365920 CCTCAGGAAGCTGAGGTGGGAGG + Intronic
1103770535 12:123319514-123319536 GCTCAGAAGGCAGAGGTGGGAGG - Intronic
1103811203 12:123615302-123615324 CCGCAAATTGCAAAGGTGGGTGG + Exonic
1104040614 12:125127947-125127969 CGTCAATCACCAGATGTGGGGGG + Intronic
1104117206 12:125760991-125761013 CCTGAAACAGGGGCGGTGGGAGG + Intergenic
1104689731 12:130816354-130816376 CGTTACACAGCAGGGGTGGGGGG + Intronic
1104833313 12:131769877-131769899 CTGCAAACAGGAGAGGTGAGAGG - Intronic
1104951614 12:132443299-132443321 CCTGAAAGAGCAGTGGTGAGCGG - Intergenic
1105010613 12:132753820-132753842 ACTCAAGCGGCTGAGGTGGGAGG + Intronic
1105377782 13:19861255-19861277 ACTCAGAAAGCTGAGGTGGGAGG - Intronic
1106057690 13:26254110-26254132 CCTCAAAGAGAGGAGGAGGGAGG - Intergenic
1106528333 13:30563498-30563520 CCTCAGGAAGCTGAGGTGGGAGG + Intronic
1106738466 13:32612602-32612624 CCTCATTCAGCAGTGTTGGGAGG + Intronic
1107749991 13:43554683-43554705 ACTCAGAAGGCAGAGGTGGGAGG - Intronic
1108368805 13:49746367-49746389 ACTCAGCCAGCTGAGGTGGGAGG + Intronic
1108380710 13:49851652-49851674 ACTCAAAAGGCTGAGGTGGGAGG + Intergenic
1108525798 13:51284998-51285020 ACTCAGAAAGCTGAGGTGGGTGG - Intergenic
1108992709 13:56682080-56682102 CCTCTAAAAGCAGAGGTTGGGGG - Intergenic
1109508678 13:63338751-63338773 ACTCAGAAAGCTGAGGTGGGAGG + Intergenic
1109680720 13:65748471-65748493 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1110109934 13:71733268-71733290 ACTCAAGAGGCAGAGGTGGGAGG - Intronic
1110600104 13:77363283-77363305 CATCAGACAGGAGAGGTAGGGGG + Intergenic
1110636642 13:77774673-77774695 ACTCAAAAGGCTGAGGTGGGAGG - Intergenic
1111109896 13:83693534-83693556 ACTCAGGAAGCAGAGGTGGGAGG - Intergenic
1111235266 13:85400780-85400802 GCCCAAACAGCAAAGGTGAGTGG + Intergenic
1111574071 13:90127439-90127461 CCTGTAAAAACAGAGGTGGGAGG + Intergenic
1111733210 13:92102965-92102987 CCTCAGGAAGCTGAGGTGGGAGG - Intronic
1111820395 13:93206892-93206914 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1111910276 13:94303076-94303098 CAGCAAACAGCAGTGGTGGATGG + Intronic
1112024492 13:95399745-95399767 CCTCAGAAGGCCGAGGTGGGAGG + Intergenic
1112322220 13:98418156-98418178 CCTTGAAAAGCTGAGGTGGGAGG - Intronic
1112625080 13:101094340-101094362 CCTCACTTGGCAGAGGTGGGAGG + Intronic
1112771077 13:102795452-102795474 ACTCATGCAGCTGAGGTGGGAGG + Intronic
1113828207 13:113273318-113273340 GCTCAGAAGGCAGAGGTGGGAGG + Intergenic
1113947291 13:114051371-114051393 CCTCACGCAGCAGGCGTGGGAGG - Intronic
1114188697 14:20424199-20424221 CCTCAGAAGGCTGAGGTGGGAGG - Intergenic
1114285923 14:21243094-21243116 TCTCAAAAAGGAGAGGTGGGGGG + Intronic
1114384823 14:22243779-22243801 CAGCAAACAGCAGTGGTGGATGG - Intergenic
1114445244 14:22783304-22783326 CCTCAGATAGCTGAGGTGGAAGG - Intronic
1115524119 14:34262382-34262404 CCTCGAAGTGCAGAGATGGGAGG - Intronic
1116118809 14:40694756-40694778 CGCCAAACAGCAGTGGTGGATGG + Intergenic
1116805017 14:49485411-49485433 CGTCAAACAGCAGAAATGGATGG + Intergenic
1117059936 14:51951805-51951827 TCTAAAACAGCAGAGTAGGGTGG + Intronic
1117127929 14:52651177-52651199 ACTCAGAAAGCTGAGGTGGGAGG + Intronic
1117586553 14:57213271-57213293 ACTCAAGAAGCTGAGGTGGGAGG + Intronic
1117610608 14:57479330-57479352 ACTCAAAAGGCTGAGGTGGGAGG - Intronic
1118058405 14:62107322-62107344 CCTCAGGAAGCTGAGGTGGGAGG + Exonic
1118062992 14:62161319-62161341 CCTCAAACACTAGAGGAGAGGGG - Intergenic
1118232979 14:63971218-63971240 ACTCAGAAAGCTGAGGTGGGAGG - Intronic
1118333593 14:64833258-64833280 CCGCGCCCAGCAGAGGTGGGAGG - Intronic
1118507501 14:66429510-66429532 ACTCAAGAAGCTGAGGTGGGAGG + Intergenic
1118622752 14:67629039-67629061 CTTCAAAAAGCAGGGCTGGGTGG + Intronic
1118745433 14:68769831-68769853 ACTCAAGAAGCTGAGGTGGGAGG - Intergenic
1118990667 14:70794279-70794301 GCTGAAAGAGCAGAGGTGAGTGG - Intronic
1119052887 14:71387365-71387387 CCTCAGAAGGCTGAGGTGGGAGG + Intronic
1119089946 14:71772217-71772239 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1119396956 14:74333379-74333401 TCTCAAAAAAAAGAGGTGGGAGG + Intronic
1119487564 14:75001049-75001071 ACTCAAAAGGCTGAGGTGGGAGG + Intergenic
1119564279 14:75615446-75615468 TCTCACACAGCAGAGGTGACAGG - Intronic
1119745982 14:77044271-77044293 CCTCAACCAGGAGAGCTTGGTGG + Intergenic
1120107987 14:80517978-80518000 CAGCAAACAGCAGTGGTGGACGG + Intronic
1120244239 14:81987610-81987632 CCTCAAACTGCCGGGGTTGGGGG - Intergenic
1120397381 14:83985581-83985603 GCGCAAACAGCAGTGGTGGATGG - Intergenic
1121040636 14:90743892-90743914 CCTCAGACAGAGGAGGTTGGAGG - Intronic
1121131400 14:91450753-91450775 ACTCAAAAGGCTGAGGTGGGAGG - Intergenic
1121236309 14:92393650-92393672 ACTCAGAAGGCAGAGGTGGGAGG - Intronic
1121278601 14:92684872-92684894 CCTCAAGCAGAGGTGGTGGGCGG + Intronic
1121450100 14:94001489-94001511 CCTCAGGCAGCAGAGGGGAGAGG - Intergenic
1122053048 14:99073328-99073350 CCTCCAAGGGCAGAGGTTGGTGG - Intergenic
1122093307 14:99353969-99353991 CCTCAAACAGCAAAAGGGTGAGG + Intergenic
1122168320 14:99848852-99848874 CCTCAGAAGGCTGAGGTGGGAGG + Intronic
1122537603 14:102476932-102476954 GCTCAAGAAGCTGAGGTGGGAGG + Intronic
1122972566 14:105158354-105158376 CCTCACACAGAACAGGTGGCAGG + Intronic
1123432995 15:20234176-20234198 ACTCAGGAAGCAGAGGTGGGGGG + Intergenic
1124342857 15:28901298-28901320 CCCCAAACCCCAGAGCTGGGTGG - Intronic
1124457765 15:29860018-29860040 CCTCAAACAGGAGCTGTGGGTGG + Intronic
1125634967 15:41179812-41179834 ACTCAGAAGGCAGAGGTGGGAGG + Intergenic
1126615665 15:50577001-50577023 ACTCAGAAGGCAGAGGTGGGAGG + Intronic
1127171126 15:56302410-56302432 ACTCAGAAAGCTGAGGTGGGAGG + Intronic
1127817019 15:62620082-62620104 ACTCAAGAAGCTGAGGTGGGAGG - Intronic
1128603762 15:69018969-69018991 ACTCTAGCAGCTGAGGTGGGAGG - Intronic
1129676506 15:77634762-77634784 TCACAAACAGCCGGGGTGGGGGG - Intronic
1129776379 15:78239329-78239351 CGGCAAACAGCAGTGGTGGACGG + Intronic
1130533728 15:84767983-84768005 ACTCAAAAGGCTGAGGTGGGAGG - Intronic
1131673844 15:94651138-94651160 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1131700748 15:94933560-94933582 ACTCCAAAAGCTGAGGTGGGAGG - Intergenic
1132199661 15:99942664-99942686 ACTCAGAAAGCTGAGGTGGGAGG - Intergenic
1132852610 16:2031532-2031554 CCTGAAATAGCAGAGGGGGAAGG - Intronic
1132928769 16:2447784-2447806 CCTCTGAGAGCAGAGGTGGGGGG - Intronic
1133052718 16:3126544-3126566 ACTCAGAAAGCTGAGGTGGGAGG - Intergenic
1133107903 16:3525671-3525693 ACTCAAGAAGCTGAGGTGGGAGG - Intronic
1133312136 16:4855505-4855527 ACTCAGAAAGCTGAGGTGGGAGG + Intronic
1133417904 16:5620785-5620807 ACTCAAGCAGCTGAGGTGGGAGG - Intergenic
1133757168 16:8770546-8770568 ACTCAAGAAGCTGAGGTGGGAGG - Intronic
1135568022 16:23527069-23527091 GCTCAGGCAGCTGAGGTGGGAGG - Intronic
1135614552 16:23899744-23899766 CCTCAGAAGGCTGAGGTGGGAGG - Intronic
1136099363 16:27982255-27982277 ACTCAAAAAGCTGTGGTGGGAGG + Intronic
1137460077 16:48652744-48652766 ACTCAAAAGGCTGAGGTGGGAGG + Intergenic
1137480433 16:48848119-48848141 ACTCAAGTTGCAGAGGTGGGAGG - Intergenic
1137957385 16:52845784-52845806 ACTCAAGAAGCTGAGGTGGGAGG - Intergenic
1138203413 16:55106755-55106777 CCTTAAATACCAGAGGTGTGTGG - Intergenic
1138367216 16:56490006-56490028 ACTCCAGCAGCTGAGGTGGGAGG + Intronic
1139396009 16:66639772-66639794 CATCAAAAGGCTGAGGTGGGTGG + Intronic
1140134461 16:72193279-72193301 GCTCAAGAAGCTGAGGTGGGAGG + Intergenic
1140548793 16:75840409-75840431 TCTCAGAAAGCTGAGGTGGGAGG + Intergenic
1141645173 16:85363577-85363599 CCACACACAGCAGAGGAAGGAGG + Intergenic
1141649238 16:85384366-85384388 CAGTAAACAGCAGAGGTGGGAGG - Intergenic
1141708617 16:85684223-85684245 ACTCAAGAAGCAGAAGTGGGAGG + Intronic
1141979231 16:87539528-87539550 ACTCAAGAAGCTGAGGTGGGAGG - Intergenic
1141991313 16:87612067-87612089 CCTCAATCAGCACCTGTGGGTGG - Intronic
1143054710 17:4154200-4154222 ACTCAACAAGCTGAGGTGGGAGG + Intronic
1143838963 17:9715342-9715364 ACTCAAAAGGCTGAGGTGGGAGG + Intronic
1144392521 17:14807993-14808015 ACTCAGGCAGCTGAGGTGGGAGG + Intergenic
1144650917 17:17006219-17006241 ACTCAGAAAGCTGAGGTGGGAGG + Intergenic
1145039191 17:19564240-19564262 ACTCAAGAAGCTGAGGTGGGAGG + Intronic
1146272812 17:31495481-31495503 ACTCAGGCAGCTGAGGTGGGAGG - Intronic
1146355988 17:32134828-32134850 ACTCAAAAGGCTGAGGTGGGAGG + Intergenic
1147174674 17:38647277-38647299 ACTCAGGCAGCTGAGGTGGGAGG + Intergenic
1147454932 17:40531243-40531265 GATCAAACATCAGAGGAGGGAGG - Intergenic
1147691273 17:42316342-42316364 ACTCAAGAAGCTGAGGTGGGAGG - Intronic
1149243112 17:54673775-54673797 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1149764243 17:59261740-59261762 ACTCAAAAGGCTGAGGTGGGAGG - Intronic
1149920495 17:60654393-60654415 TCCCAAGCAGCTGAGGTGGGAGG + Intronic
1150327631 17:64269450-64269472 CCTTAAATAGCAGAAGTGGAAGG + Intergenic
1151406226 17:73888382-73888404 CCTCAACAAGGAGAGGTGGAAGG + Intergenic
1151827026 17:76529362-76529384 CCACAAGGAGCAGAAGTGGGCGG + Intronic
1152438061 17:80288220-80288242 CCTTCACCAGCAGAGGTGGGGGG - Exonic
1152653128 17:81505566-81505588 ACTCAAGCGGCTGAGGTGGGAGG + Intergenic
1152932831 17:83119059-83119081 GCTCAAAGAACAGAGATGGGTGG + Intergenic
1152975199 18:209600-209622 TGTCAAACCACAGAGGTGGGGGG - Intronic
1153400773 18:4682045-4682067 CAGCAAACAGCAGTGGTGGATGG - Intergenic
1153402050 18:4692000-4692022 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1153716322 18:7852745-7852767 ACTCAGAATGCAGAGGTGGGAGG + Intronic
1154533791 18:15375853-15375875 CCTAACCCAGCAGGGGTGGGTGG - Intergenic
1154962679 18:21325703-21325725 ACTCAGAGAGCTGAGGTGGGAGG + Intronic
1155495170 18:26435780-26435802 CCTCCAACAGGAGAGGTGGGTGG - Intergenic
1156132834 18:33999254-33999276 ACTCAAGAGGCAGAGGTGGGAGG - Intronic
1156549443 18:37999986-38000008 ACTCAAGAAGCTGAGGTGGGAGG + Intergenic
1157259332 18:46165103-46165125 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1157536022 18:48457914-48457936 ACTCAAAAGGCAGAGGCGGGAGG + Intergenic
1157772673 18:50363354-50363376 CCTCAGAAGGCTGAGGTGGGAGG - Intergenic
1158152293 18:54386967-54386989 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1158257385 18:55567467-55567489 ACACAATCAACAGAGGTGGGTGG + Intronic
1158943410 18:62427122-62427144 ACTCAAAAGGCTGAGGTGGGAGG + Intergenic
1159229480 18:65587713-65587735 ACTCAAGAAGCTGAGGTGGGAGG - Intergenic
1159914495 18:74176509-74176531 CCTGAAGCTGCAGAGGCGGGAGG - Intergenic
1160057977 18:75503900-75503922 CATCAAAAAGCAAAGGTGGCAGG - Intergenic
1160152734 18:76407314-76407336 ACTCGAACAGCTGAGGTGAGAGG + Intronic
1160373353 18:78391987-78392009 CCTCACACAGCAGTAGTGGGGGG + Intergenic
1160506686 18:79431129-79431151 CCCCACAGAGCGGAGGTGGGTGG + Intronic
1160531036 18:79563137-79563159 CTTCAGGAAGCAGAGGTGGGAGG - Intergenic
1161193108 19:2970513-2970535 ACTCAAAAGGCTGAGGTGGGAGG + Intergenic
1161348363 19:3778931-3778953 GGTCATACAGCAGAGCTGGGGGG + Intronic
1161435738 19:4261863-4261885 CCTCAGTGAGCAGGGGTGGGAGG - Intronic
1161598436 19:5164932-5164954 CCTCGGAGAGGAGAGGTGGGAGG + Intronic
1161820105 19:6525261-6525283 ACTCAAGAAGCTGAGGTGGGAGG - Intergenic
1161841150 19:6681285-6681307 ACTCAGGAAGCAGAGGTGGGAGG + Intronic
1161868615 19:6853353-6853375 CCTCGAACCCAAGAGGTGGGAGG - Intronic
1162081991 19:8223675-8223697 ACTCAGAAAGCTGAGGTGGGAGG + Intronic
1162101539 19:8342351-8342373 CCTGAAGCCGCAGAGGTGGTGGG - Intronic
1162368279 19:10262816-10262838 CCACAAACTGCAGGGGTTGGGGG + Intergenic
1162375632 19:10303671-10303693 CTTCAGAAGGCAGAGGTGGGAGG - Intergenic
1162892175 19:13741626-13741648 ACTCAAAAAGCTGAGGTGTGAGG + Intronic
1162923175 19:13915720-13915742 CCTCGAGAAGCTGAGGTGGGAGG + Intronic
1163006625 19:14401013-14401035 ACTCAGAAAGCTGAGGTGGGAGG + Intronic
1163390579 19:17027496-17027518 CTTCATACAGCAGGGGTGGATGG + Intergenic
1163424396 19:17233206-17233228 CCTCAAGAGGCTGAGGTGGGAGG + Intronic
1163705278 19:18808714-18808736 CCTCAAAAAATAGAGGTTGGGGG + Intergenic
1163853512 19:19681005-19681027 GCTCAGAAAGCTGAGGTGGGAGG + Exonic
1164173170 19:22745520-22745542 CAGCAAACAGCAGTGGTGGATGG - Intergenic
1164559491 19:29279508-29279530 ACTCCAAAAGCCGAGGTGGGAGG - Intergenic
1165397262 19:35571347-35571369 ACTCAAGAAGCTGAGGTGGGAGG - Intergenic
1165747125 19:38236185-38236207 CCTAAAACAACAGAAATGGGCGG + Intergenic
1165877216 19:39016674-39016696 ACTCAAGAAGCTGAGGTGGGAGG + Intronic
1166089899 19:40502106-40502128 CCTGACACAGCAGAGGAAGGGGG - Exonic
1166092112 19:40516409-40516431 CCTCAGGAGGCAGAGGTGGGAGG - Intronic
1166630706 19:44404515-44404537 GCTCAAGCAGCTGAGGTGGGAGG + Intergenic
1166753469 19:45176559-45176581 ACTCAGGAAGCAGAGGTGGGAGG - Intronic
1167068867 19:47207741-47207763 CCTCAGGAAGCTGAGGTGGGAGG - Intronic
1167210766 19:48132919-48132941 CGTCAAAGAGCAGGGGTGTGGGG - Intronic
1167409138 19:49334782-49334804 ACTCAGAAGGCAGAGGTGGGAGG + Intergenic
1167483368 19:49746346-49746368 TCTCAAGTAGCTGAGGTGGGCGG - Intronic
1167483402 19:49746462-49746484 CATCGAAGAGCTGAGGTGGGCGG - Exonic
1167604246 19:50472785-50472807 ACTCAGGCAGCTGAGGTGGGAGG + Intronic
1167800195 19:51735738-51735760 CCTGAAACAGCAGAGTTTGAAGG + Intergenic
1168070853 19:53950792-53950814 CCTCAGGAAGCTGAGGTGGGAGG - Intergenic
1168147019 19:54425248-54425270 CGGCAAACAGCAGTGGTGGACGG + Intronic
1168521612 19:57055602-57055624 CCTCACATGGCAGAGGTGGTGGG + Intergenic
925023807 2:592583-592605 CAGCAAACAGCAGTGGTGGAGGG - Intergenic
925483020 2:4297578-4297600 CCTCAAAAAGTAGAGATGGGTGG + Intergenic
926054684 2:9767735-9767757 CCTGACTCAGCAGAGTTGGGGGG - Intergenic
926288582 2:11510545-11510567 GCTCACACAGGAAAGGTGGGAGG + Intergenic
926524159 2:13955559-13955581 CTTTAGAAAGCAGAGGTGGGAGG - Intergenic
927128849 2:20039603-20039625 ACTCAGGCAGCTGAGGTGGGAGG + Intronic
927674415 2:25094174-25094196 ACTCAGAAAGCTGAGGTGGGAGG + Intronic
928055279 2:28046875-28046897 ACTCAGAAAGCTGAGGTGGGAGG - Intronic
928988223 2:37201880-37201902 TCTCAAACAGCTTAGATGGGAGG - Exonic
929152152 2:38757242-38757264 ACTCATAAGGCAGAGGTGGGTGG + Intronic
929542353 2:42832094-42832116 CGGCAAACAGCAGTGGTGGACGG - Intergenic
930124865 2:47787723-47787745 ACTCAGAAAGCTGAGGTGGGAGG - Intronic
930158138 2:48126486-48126508 ACTCAGAAAGCTGAGGTGGGAGG - Intergenic
931038980 2:58275750-58275772 CGGCAAACAGCAGTGGTGGACGG - Intergenic
931313316 2:61103243-61103265 CCTCAGGAAGCTGAGGTGGGAGG - Intronic
931399259 2:61915596-61915618 ACTCAAAAGGCTGAGGTGGGAGG - Intronic
931563140 2:63585933-63585955 CCTCAAGAGGCTGAGGTGGGAGG - Intronic
931612146 2:64113191-64113213 ACTCAGAAAGCTGAGGTGGGAGG + Intronic
931614093 2:64138178-64138200 ACTCAAGAAGCTGAGGTGGGAGG - Intronic
932711163 2:74064506-74064528 ACTCAAACGGCTGAGGTGGGAGG - Intronic
932917171 2:75872053-75872075 CGGCAAACAGCAGTGGTGGATGG - Intergenic
934331661 2:92074448-92074470 CCGCAAAAAGCAGCGGTGGTGGG - Intergenic
934663121 2:96153660-96153682 TCTCAGACAGCACAGGTGAGTGG + Intergenic
934680933 2:96283527-96283549 CATCCAACGGCAGAGGTAGGTGG - Exonic
935515615 2:104034303-104034325 ACTCAAGAAGCTGAGGTGGGAGG + Intergenic
935625321 2:105167884-105167906 CCACATACAGCAGAAGGGGGAGG - Intergenic
935748347 2:106209327-106209349 CAGCAAACAGCAGTGGTGGATGG - Intergenic
936428084 2:112436235-112436257 GAACAAACAGCAGGGGTGGGGGG - Intergenic
936878287 2:117218861-117218883 CCTGGAAGAGCAGAGGAGGGTGG + Intergenic
937231722 2:120401750-120401772 CCTAGAACAGCAAAGATGGGAGG - Intergenic
937240767 2:120460986-120461008 CCTCTATCAGGAAAGGTGGGTGG - Intergenic
937666105 2:124488948-124488970 CCTGATTCAGCAGAGGTGGCAGG + Intronic
937950105 2:127378873-127378895 ACTCAAAAGGCTGAGGTGGGAGG - Intronic
937950110 2:127378899-127378921 ACTCAAAAGGCTGAGGTGGGAGG - Intronic
937974735 2:127575727-127575749 ACTCAAAAGGCTGAGGTGGGAGG - Intronic
938713662 2:133998812-133998834 ACTCAGACGGCTGAGGTGGGAGG - Intergenic
939134088 2:138273520-138273542 CGGCAAACAGCAGTGGTGGACGG + Intergenic
939279343 2:140042350-140042372 CCTCACACCAGAGAGGTGGGAGG - Intergenic
939983508 2:148808189-148808211 ACTCAGAAGGCAGAGGTGGGAGG + Intergenic
940739812 2:157494143-157494165 CCTCCCAGAGCAGAGGTGAGGGG + Intergenic
942399406 2:175585618-175585640 ACTCCAACAGCAGAGATGAGTGG + Intergenic
942951929 2:181731213-181731235 CCTCAGAAGGCTGAGGTGGGAGG + Intergenic
943502391 2:188708205-188708227 CCTCAGACAGCATGGATGGGTGG + Intergenic
943590878 2:189794989-189795011 CCTCAAGAGGCTGAGGTGGGAGG + Intronic
943634280 2:190288040-190288062 GCTCAGAAAGCTGAGGTGGGAGG + Intronic
946098954 2:217302290-217302312 CCCAAAACAGCAGGGGTGGGGGG + Intronic
947602036 2:231458422-231458444 CCTGAAAAACCAAAGGTGGGGGG + Intronic
948107012 2:235422263-235422285 ACTCAAAAGGCTGAGGTGGGAGG + Intergenic
948781458 2:240324229-240324251 CCTCAAACAGCAGTGGGGCCCGG + Intergenic
948953060 2:241267447-241267469 CCCCTAACCGCAGGGGTGGGGGG + Intronic
1168891715 20:1299334-1299356 CCTCAAGGAGCAGAGTTGGATGG + Intronic
1169147289 20:3261148-3261170 ACTCAAGAAGCTGAGGTGGGAGG - Intronic
1169287280 20:4320242-4320264 ACTCAAAAGGCTGAGGTGGGAGG - Intergenic
1169344597 20:4820400-4820422 CCTCAAGAGGCTGAGGTGGGAGG + Intronic
1169442785 20:5646836-5646858 ACTCAAGACGCAGAGGTGGGGGG + Intergenic
1169461239 20:5797451-5797473 ACTCAAGAGGCAGAGGTGGGAGG + Intronic
1169545652 20:6648062-6648084 CCTCAAGCAATAAAGGTGGGAGG + Intergenic
1170612144 20:17923380-17923402 CCTCAGTCAGCAGTGGGGGGCGG - Intergenic
1170624551 20:18021344-18021366 GTTCAAACAGCAGAGGGGTGAGG + Intronic
1170706189 20:18746584-18746606 ACTCAGAAAGCTGAGGTGGGAGG + Intronic
1170934992 20:20801944-20801966 ACTCAAAAGGCTGAGGTGGGAGG + Intergenic
1171500797 20:25591493-25591515 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1171974390 20:31585079-31585101 CCTCAAGAAGCTGAGGCGGGAGG + Intergenic
1172075202 20:32290768-32290790 ACTCAAAAGGCTGAGGTGGGAGG + Intronic
1172433149 20:34909257-34909279 GCTCAAGAGGCAGAGGTGGGAGG + Intronic
1172669575 20:36625716-36625738 ACTCAAGAAGCTGAGGTGGGAGG + Intronic
1172781662 20:37440101-37440123 AAGCAAACAGCAGAGGTGGCAGG - Intergenic
1172947191 20:38698744-38698766 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1173745382 20:45432857-45432879 ACTCAAAAGGCTGAGGTGGGAGG - Intergenic
1173903926 20:46612238-46612260 ACTCAGAAAGCTGAGGTGGGCGG - Intronic
1174016671 20:47494304-47494326 ACTCAAGAAGCTGAGGTGGGAGG - Intergenic
1174390693 20:50216717-50216739 CCTCCCAGAGCAGAGCTGGGAGG + Intergenic
1174945558 20:54981302-54981324 ACTCAAGAAGCTGAGGTGGGAGG + Intergenic
1175479496 20:59301326-59301348 CCCCAAACACCTGAGGAGGGGGG - Intronic
1175856629 20:62123980-62124002 CCTCTAGGGGCAGAGGTGGGTGG - Intronic
1175995376 20:62809914-62809936 CCTGAAACAGGAGAGGGGGCAGG + Intronic
1176063218 20:63181287-63181309 CCACGAGCAGCAGAGGTGGGAGG + Intergenic
1176374169 21:6078976-6078998 GAACAAACAGCAGGGGTGGGAGG + Intergenic
1177141040 21:17358392-17358414 ACTCAAAAGGCTGAGGTGGGAGG + Intergenic
1177263980 21:18760153-18760175 CAGCAAACAGCAGTGGTGGACGG + Intergenic
1177359363 21:20048656-20048678 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1177895730 21:26854808-26854830 CGGCAAACAGCAGTGGTGGAAGG - Intergenic
1177896702 21:26861644-26861666 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1178956517 21:37027718-37027740 ACTCAGAAAGCTGAGGTGGGAGG - Intergenic
1179232180 21:39514468-39514490 ACTCAAGAAGCTGAGGTGGGAGG - Intronic
1179749308 21:43459269-43459291 GAACAAACAGCAGGGGTGGGAGG - Intergenic
1180224699 21:46385245-46385267 TCTCAGAAAGCTGAGGTGGGAGG + Intronic
1180739884 22:18045700-18045722 ACTCAGGAAGCAGAGGTGGGAGG - Intergenic
1181137163 22:20776213-20776235 CTTCAAAAGGCTGAGGTGGGAGG + Intronic
1181345518 22:22217516-22217538 ACTCAAGGAGCTGAGGTGGGAGG - Intergenic
1181391458 22:22585741-22585763 ACTCAGAAAGCTGAGGTGGGAGG - Intergenic
1181408320 22:22700883-22700905 CCCCACACAGCTGAGGTGTGGGG + Intergenic
1181552911 22:23651106-23651128 ACTCAGAAAGCTGAGGTGGGAGG + Intergenic
1182026373 22:27122416-27122438 CTTCAGAAGGCAGAGGTGGGTGG - Intergenic
1182105171 22:27683924-27683946 CCTCAGGAGGCAGAGGTGGGAGG + Intergenic
1182217554 22:28731769-28731791 CTTAGAGCAGCAGAGGTGGGAGG - Intronic
1182690981 22:32162361-32162383 CTTCAAAAAGCAGAGGAGTGGGG + Intergenic
1182738152 22:32546036-32546058 ACTCAAGTGGCAGAGGTGGGAGG - Intronic
1182820223 22:33209752-33209774 CCTCAGGAAGCTGAGGTGGGAGG - Intronic
1183260086 22:36789162-36789184 CCTCCAGAGGCAGAGGTGGGAGG - Intergenic
1183369234 22:37423145-37423167 CCTCGAACAGCAGCGCTTGGAGG - Intronic
1183551966 22:38493534-38493556 CCTAAAACAGCAGTGCTGAGTGG + Intronic
1183599325 22:38830886-38830908 CCTCTTACACAAGAGGTGGGGGG - Intronic
1184010269 22:41742759-41742781 ACTCAAGAGGCAGAGGTGGGAGG - Intronic
1184194787 22:42919997-42920019 ACTCAAGAAGCTGAGGTGGGAGG + Intronic
1184863176 22:47188441-47188463 CCACATCCAGCAGAGGTGTGTGG + Intergenic
1185349185 22:50325748-50325770 CCTCAAACAGCATCACTGGGTGG - Intronic
949483077 3:4512210-4512232 TCTTAAACAGCCAAGGTGGGAGG - Intronic
949555911 3:5152591-5152613 ACTCAAATGGCTGAGGTGGGAGG - Intronic
949677202 3:6469302-6469324 CCTCACATAGCAGAAGTGGGAGG - Intergenic
949811676 3:8012972-8012994 CAGCAAACAGCAGTGGTGGATGG + Intergenic
950884736 3:16353376-16353398 CTTCAAAGAGCTGAGGTGCGGGG + Intronic
950939540 3:16879334-16879356 CCTTAGACAGCAGGGGTGGTAGG + Intronic
951016256 3:17735811-17735833 CAGCAAACAGCAGTGGTGGATGG + Intronic
951910063 3:27741007-27741029 ATTCAAGCAGCTGAGGTGGGAGG + Intergenic
952384295 3:32828614-32828636 TCTCAGAAGGCAGAGGTGGGAGG - Intronic
952427640 3:33191834-33191856 ACTCAGGCAGCTGAGGTGGGAGG + Intronic
952917645 3:38261181-38261203 CCTCAGGAAGCAGAGGTGGGAGG + Intergenic
952921717 3:38289782-38289804 CGACAAACAGCAGTGGTGGACGG + Intronic
952922699 3:38296929-38296951 CGACAAACAGCAGTGGTGGACGG + Intronic
953576330 3:44115802-44115824 CCTCAGGCAGCTGAGGTGGGAGG + Intergenic
953932494 3:47012660-47012682 GCTCGAACTGCAGAGCTGGGAGG + Intergenic
954240387 3:49289000-49289022 ACTCAAAAGGCTGAGGTGGGAGG + Intronic
954806453 3:53223675-53223697 CCTTTACCAGCAGGGGTGGGAGG + Intergenic
955908179 3:63829854-63829876 CCTCAGAAGGCTGAGGTGGGAGG + Intronic
956824097 3:72981593-72981615 CCTCAGAAAGCTGAGGTGGGAGG + Intronic
957000509 3:74877945-74877967 CAGCAAACAGCAGTGGTGGATGG + Intergenic
957214409 3:77300793-77300815 CCTAAAACAGGAGAGTTGGGGGG + Intronic
957687039 3:83515284-83515306 CAGCAAACAGCAGTGGTGGACGG - Intergenic
958170632 3:89935220-89935242 ACTCAACAAGCTGAGGTGGGAGG - Intergenic
959062812 3:101631606-101631628 CCTCAGGCAGCTGAGGTGGGAGG + Intergenic
959117388 3:102194387-102194409 CATCAAAATGCAGAGGTGGTGGG + Intronic
959178426 3:102947781-102947803 TCAGAAACAGCAGAAGTGGGAGG + Intergenic
959473234 3:106778838-106778860 ACTCAGGCAGCTGAGGTGGGAGG - Intergenic
960006990 3:112790777-112790799 CGGCAAACAGCAGTGGTGGATGG + Intronic
960714343 3:120560414-120560436 ACTCAGAAAGCTGAGGTGGGAGG + Intergenic
961833112 3:129634702-129634724 CCTCAAGTGGCTGAGGTGGGAGG - Intergenic
962629753 3:137263993-137264015 CCTGCCACAGCAGGGGTGGGAGG + Intergenic
963207485 3:142651568-142651590 ACTCAAAAGGCTGAGGTGGGAGG - Intronic
964113361 3:153110266-153110288 ACTCAAAAGGCTGAGGTGGGAGG - Intergenic
964332414 3:155618752-155618774 CCTCAGGAAGCTGAGGTGGGAGG - Intronic
965113041 3:164451556-164451578 CAACAAATAGCAGGGGTGGGTGG + Intergenic
965356939 3:167686951-167686973 ACTACAACAGCAGAGATGGGTGG + Intronic
965834195 3:172832749-172832771 TCTCAAATTACAGAGGTGGGTGG + Intergenic
966556826 3:181271728-181271750 CCACAGACAGGGGAGGTGGGGGG - Intergenic
966661777 3:182422519-182422541 ACTCAAGAGGCAGAGGTGGGAGG + Intergenic
966817453 3:183900768-183900790 ACTCAGGCAGCTGAGGTGGGAGG + Intergenic
967234886 3:187374477-187374499 CCTAAACCAGCAGAGGTGTTAGG - Intergenic
967774174 3:193369133-193369155 CCTCAGGAGGCAGAGGTGGGAGG + Intronic
967830923 3:193919598-193919620 TCATAAACAGCAGAGGTGAGAGG + Intergenic
968028377 3:195462197-195462219 TCGAACACAGCAGAGGTGGGTGG + Intergenic
968404364 4:327186-327208 CCCCAAACAGCCAAGGTGGCAGG - Intergenic
969162615 4:5274794-5274816 CGGCAAACAGCAGTGGTGGACGG - Intronic
969193421 4:5542344-5542366 ACTCAGGAAGCAGAGGTGGGAGG + Intergenic
969231076 4:5831690-5831712 TCTCAAGCTGCAGAGGTGTGAGG + Intronic
969468167 4:7370071-7370093 CCGCAAACAGCTAAGCTGGGGGG - Intronic
969644229 4:8417255-8417277 CCTTAAACAGTGAAGGTGGGCGG - Intronic
969896862 4:10313484-10313506 CCTCAAAGACCACAGGAGGGAGG - Intergenic
970535632 4:17027332-17027354 CCCCACACAGCACAGGTAGGTGG + Intergenic
970678082 4:18475814-18475836 ACTCAAGAAGCTGAGGTGGGAGG + Intergenic
970738116 4:19198142-19198164 CCGCAAACAGCAGTGGTGCACGG + Intergenic
970982872 4:22122645-22122667 CCTCATATGGCTGAGGTGGGAGG + Intergenic
972440548 4:39086146-39086168 ACTCTAACACCAGAAGTGGGTGG - Intronic
972662917 4:41134077-41134099 ACTCAAGAGGCAGAGGTGGGTGG - Intronic
972766775 4:42158571-42158593 CGGCAAACAGCAGTGGTGGACGG + Intergenic
973859857 4:55052438-55052460 CCTCAAGAGGCTGAGGTGGGAGG - Intergenic
974487853 4:62526898-62526920 CAGCAAACAGCAGTGGTGGACGG + Intergenic
975313230 4:72926028-72926050 CGGCAAACAGCAGTGGTGGACGG + Intergenic
975418825 4:74138679-74138701 CAGCAAACAGCAGTGGTGGATGG + Intronic
976196450 4:82536631-82536653 CCTCAGGAGGCAGAGGTGGGAGG + Intronic
976714576 4:88110056-88110078 ACTCAAAAGGCTGAGGTGGGAGG - Intronic
976816694 4:89156471-89156493 CCTCAAGCTGCAGAGTTGAGAGG - Intergenic
977034273 4:91929618-91929640 CCTACTACAGCTGAGGTGGGAGG - Intergenic
977251317 4:94692625-94692647 CGGCAAACAGCAGTGGTGGACGG - Intergenic
978371505 4:108034018-108034040 CTTCAGGCAGCACAGGTGGGTGG + Intronic
978492741 4:109326214-109326236 ACTCAAGAAGCTGAGGTGGGAGG + Intergenic
978539615 4:109803182-109803204 CCGAGACCAGCAGAGGTGGGAGG - Intergenic
979211236 4:118106452-118106474 ACTCAAAAGGCTGAGGTGGGAGG - Intronic
979547937 4:121957952-121957974 CCTCAGGAAGCTGAGGTGGGAGG + Intergenic
979577297 4:122308971-122308993 CCATAAACACCACAGGTGGGTGG + Intronic
979644160 4:123047941-123047963 ACTCAGGAAGCAGAGGTGGGAGG - Intronic
979699556 4:123652783-123652805 CCTCTAACAGCAGATCTGGCTGG - Intergenic
980135616 4:128855926-128855948 ACTCAAAAGGCTGAGGTGGGAGG - Intronic
980190519 4:129519325-129519347 CAGCAAACAGCAGTGGTGGACGG - Intergenic
980523646 4:133961712-133961734 CAGCAAACAGCAGTGGTGGACGG - Intergenic
980625711 4:135372297-135372319 CGGCAAACAGCAGTGGTGGATGG - Intergenic
980790429 4:137613267-137613289 CGTCAAGCAGCAGTGGTGGATGG - Intergenic
982055306 4:151543189-151543211 CCTCATCCAGCAGATGTGGCAGG + Intronic
982375647 4:154687910-154687932 ACTCAGGAAGCAGAGGTGGGAGG - Intronic
983041897 4:162938940-162938962 CCTGGAGCAGCTGAGGTGGGAGG - Intergenic
983185849 4:164699722-164699744 CCTCCGAAGGCAGAGGTGGGAGG - Intergenic
983667444 4:170196968-170196990 CGGCAAACAGCAGTGGTGGATGG + Intergenic
984169215 4:176341508-176341530 ACTCAAGGAGCTGAGGTGGGAGG - Intergenic
984490562 4:180430176-180430198 CCTCACACAGCAGAGGTGAAAGG + Intergenic
984575149 4:181439063-181439085 TCTCAGAAAGCTGAGGTGGGAGG - Intergenic
984759546 4:183351839-183351861 CCCTAAACAGCAGAGGTGACGGG - Intergenic
985049627 4:185975792-185975814 ACTCAGGAAGCAGAGGTGGGAGG + Intergenic
985244394 4:187965169-187965191 ACTCAAGTAGCTGAGGTGGGAGG + Intergenic
985263117 4:188133207-188133229 ACTCAAAAGGCTGAGGTGGGAGG + Intergenic
985762180 5:1754991-1755013 CCTCACACAGCAGAGAGAGGAGG - Intergenic
986018605 5:3780326-3780348 ACTCAGAAAGCTGAGGTGGGAGG - Intergenic
986587185 5:9330549-9330571 GCTAAATCAGCAGAGCTGGGAGG + Intronic
986821978 5:11477518-11477540 ACTCAGGCAGCTGAGGTGGGAGG - Intronic
988274801 5:29067765-29067787 CCTAATACAGCAGTGTTGGGAGG + Intergenic
988718897 5:33856248-33856270 TCTCAAACAGCAGTGCAGGGAGG - Intronic
988740545 5:34064672-34064694 CGGCAAACAGCAGTGGTGGATGG + Intronic
988777728 5:34492181-34492203 ACTCAAAAGGCTGAGGTGGGAGG - Intergenic
988957400 5:36332981-36333003 CGGCAAACAGCAGTGGTGGATGG + Intergenic
989365804 5:40653632-40653654 ACTCAAAAAGCTGAGGTGGGAGG + Intergenic
989466272 5:41759118-41759140 CCTGAAAGGGCAGATGTGGGTGG + Intronic
989588827 5:43094674-43094696 ACTCAGACAGGAGATGTGGGGGG - Intronic
989972253 5:50538874-50538896 CCTCATGCAGCACAGGTTGGTGG - Intergenic
990375608 5:55167614-55167636 CTTTAAGCAGCTGAGGTGGGAGG + Intronic
990663305 5:58043188-58043210 CCACAAACAGAAAATGTGGGTGG + Intergenic
991928830 5:71731578-71731600 GCTCAAAAGGCTGAGGTGGGAGG + Intergenic
992293493 5:75304574-75304596 CGGCAAACAGCAGTGGTGGATGG - Intergenic
992521356 5:77554982-77555004 ACTCAAGAAGCTGAGGTGGGAGG + Intronic
992968358 5:82027288-82027310 ACTCAAAAGGCTGAGGTGGGAGG + Intronic
993921501 5:93810509-93810531 ACTCAAGAAGCTGAGGTGGGAGG - Intronic
994179927 5:96753100-96753122 CCTCAAGAGGCTGAGGTGGGAGG - Intronic
994297772 5:98111859-98111881 CCTCACATAGCAGAGGTGCTAGG + Intergenic
995437095 5:112148843-112148865 CCCAAATCAGCAGAGGAGGGAGG - Intronic
995930695 5:117439174-117439196 ACTCAAGAAGCTGAGGTGGGAGG - Intergenic
996442427 5:123507220-123507242 CCACAATAAGCATAGGTGGGAGG + Intergenic
996801536 5:127408966-127408988 ACTCAGGCGGCAGAGGTGGGAGG + Intronic
997042068 5:130268452-130268474 CCTCTAACAGCGCAGGTGTGGGG + Intergenic
998166247 5:139846053-139846075 ACCCAAACAGCTGAGGTGGTTGG - Intergenic
998265461 5:140664759-140664781 CCTCTTACAGGAGAGGTGGGTGG - Exonic
998997051 5:147877222-147877244 CCTCAAAGAGCCAAGGTTGGTGG - Intronic
999423712 5:151467650-151467672 TCTCAAACAACAGAGGCCGGTGG - Intronic
1000235329 5:159354085-159354107 ACTCAGAAAGCTGAGGTGGGAGG - Intergenic
1000478895 5:161746359-161746381 ACTCAAGAAGCTGAGGTGGGAGG - Intergenic
1001055611 5:168447393-168447415 ACTGCAACAGCAGAGGTGAGGGG - Intronic
1001500323 5:172227226-172227248 CTGCAAACAGCTGAGGTGAGAGG - Intronic
1001724401 5:173884947-173884969 CCTCAAACCCCAGAGGGGGCTGG + Intergenic
1002105489 5:176877670-176877692 CCTCAAAAAGCAGTCGTGCGAGG + Exonic
1003605320 6:7554751-7554773 ACTCAGGCAGCTGAGGTGGGAGG - Intronic
1003878189 6:10456668-10456690 CCTCAAGAGGCTGAGGTGGGAGG + Intergenic
1004213484 6:13678008-13678030 ACTCAAGAAGCTGAGGTGGGAGG + Intronic
1004236359 6:13878455-13878477 CAGCAAACAGCAGTGGTGGACGG - Intergenic
1004378422 6:15111632-15111654 ACTCAAGAAGCTGAGGTGGGAGG + Intergenic
1004519839 6:16351509-16351531 ACTCAAGAGGCAGAGGTGGGTGG - Intronic
1004865537 6:19849922-19849944 ACTCAAAAAGCTAAGGTGGGAGG + Intergenic
1005324148 6:24682705-24682727 CGGCAAACAGCAGTGGTGGATGG + Intronic
1005604253 6:27460056-27460078 CCTCAGGAAGCTGAGGTGGGAGG + Intronic
1006201980 6:32301609-32301631 GCTCAGAAAGCTGAGGTGGGAGG + Intronic
1007168311 6:39844288-39844310 TTTCAAATAGCAGAGGTGGGGGG + Intronic
1007630003 6:43268226-43268248 CCTCTCACAGCACATGTGGGTGG - Intronic
1008181904 6:48341586-48341608 CCTCAATCATAAGATGTGGGTGG + Intergenic
1008582777 6:52921518-52921540 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1009909222 6:69904925-69904947 CCTCCACCAGCAGAGTTGGATGG - Intronic
1009953262 6:70420988-70421010 ACTCAGAAAGCTGAGGTGGGAGG - Intronic
1010125843 6:72430926-72430948 ACTCAAGTAGCTGAGGTGGGAGG + Intergenic
1011623667 6:89266169-89266191 ACTCAGAAAGCTGAGGTGGGAGG - Intronic
1012839047 6:104306323-104306345 ACTCAAACAGTTGAGGTGGAGGG + Intergenic
1012990261 6:105918646-105918668 ACTCAGAAGGCAGAGGTGGGAGG - Intergenic
1013021753 6:106228254-106228276 CGGCAAACAGCAGTGGTGGATGG - Intronic
1013112807 6:107078051-107078073 CCAAATACAGCAGATGTGGGAGG - Intronic
1013115733 6:107102488-107102510 GCTCATGCAGCTGAGGTGGGAGG + Intronic
1013445080 6:110216996-110217018 ACTCGAAAAGCTGAGGTGGGTGG + Intronic
1013540137 6:111099912-111099934 ACTCAAAAGGCTGAGGTGGGAGG + Intronic
1014208910 6:118687752-118687774 CGGCAAACAGCAGTGGTGGACGG - Intronic
1014427772 6:121330140-121330162 ACTCAGAAAGCTGAGGTGGGAGG - Intronic
1015560702 6:134512287-134512309 ACTCAGAAAGCTGAGGTGGGAGG - Intergenic
1015627102 6:135190903-135190925 ACTCAAGAAGCTGAGGTGGGAGG - Intronic
1015632764 6:135247944-135247966 CAGCAAACAGCAGTGGTGGACGG - Intergenic
1016420864 6:143881440-143881462 ACTCAAGAAGCTGAGGTGGGAGG + Intronic
1016485610 6:144534899-144534921 AGTAAAACAGCAGAGGTGGGAGG + Intronic
1016503042 6:144744179-144744201 ACTCAGAAAGCTGAGGTGGGAGG + Intronic
1016579916 6:145617831-145617853 ACTCAAGAAGCTGAGGTGGGAGG + Intronic
1016864980 6:148757104-148757126 TCTCAAGAAGCTGAGGTGGGAGG - Intronic
1017459732 6:154637662-154637684 ACTCAAGAAGCTGAGGTGGGAGG + Intergenic
1017679939 6:156853509-156853531 CCACAAAAAGCACACGTGGGAGG - Intronic
1018162817 6:161063939-161063961 CCCCAAAGAGAAGAGGTGGTGGG - Intronic
1018443904 6:163837683-163837705 ACTCCAACAGAGGAGGTGGGGGG - Intergenic
1019153342 6:170023415-170023437 CCTCCCACGGCAGAGCTGGGAGG - Intergenic
1019234365 6:170597334-170597356 ACTCAAGAAGCAGAAGTGGGAGG + Intergenic
1020649202 7:10854823-10854845 CATCAAAGAGCACAGGAGGGAGG + Intergenic
1020906203 7:14067210-14067232 CGGCAAACAGCAGTGGTGGGCGG - Intergenic
1021516113 7:21489427-21489449 ACTCAGGCAGCTGAGGTGGGAGG - Intronic
1021592183 7:22275169-22275191 CTTCACACAGGAGAGGTGAGTGG - Intronic
1021885344 7:25131953-25131975 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1022117652 7:27276465-27276487 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1022370103 7:29762828-29762850 ACTCAAAAGGCTGAGGTGGGAGG + Intergenic
1022694598 7:32691868-32691890 GAACAAACAGGAGAGGTGGGTGG + Intergenic
1023013497 7:35943346-35943368 ACTCAGAAAGCTGAGGTGGGAGG + Intergenic
1023447719 7:40249181-40249203 ACTCAGGCAGCTGAGGTGGGAGG + Intronic
1023916138 7:44590729-44590751 ACTCAAGAAGCTGAGGTGGGAGG + Intergenic
1024031200 7:45461194-45461216 CCTCAGAAAGCAGAAGTGAGTGG + Intergenic
1024077632 7:45830487-45830509 GCTCAGAAAGCTGAGGTGGGAGG - Intergenic
1024148021 7:46536784-46536806 CAGCAAACAGCAGTGGTGGATGG + Intergenic
1025126779 7:56350926-56350948 ACTCAGAAAGCTGAGGTGGGAGG + Intergenic
1025140080 7:56455575-56455597 ACTCAGAAAGCTGAGGTGGGAGG + Intergenic
1025200780 7:56960114-56960136 CCTCAGGAAGCTGAGGTGGGAGG + Intergenic
1025623933 7:63201272-63201294 ACTCAGAAAGCTGAGGTGGGAGG - Intergenic
1025671163 7:63616818-63616840 CCTCAGGAAGCTGAGGTGGGAGG - Intergenic
1025848436 7:65220908-65220930 CCTCAGATAGCAGAGGTAGGAGG + Intergenic
1025942513 7:66084586-66084608 ACTCAGAAAGCTGAGGTGGGAGG - Intronic
1026252127 7:68680154-68680176 CCTCAAGAGGCTGAGGTGGGAGG + Intergenic
1026310150 7:69176271-69176293 CCACAGACAGCGGAGGTGGGGGG - Intergenic
1026779291 7:73253815-73253837 ACTCAAAAGGCTGAGGTGGGAGG - Intergenic
1026972181 7:74475322-74475344 CCTCACAAAGTAGAGGTGGGAGG - Intronic
1026973411 7:74481261-74481283 ACTCAGAAAGCTGAGGTGGGAGG - Intronic
1027345518 7:77255599-77255621 TCTCACCCAGCAGTGGTGGGAGG + Intronic
1027615857 7:80423083-80423105 ACTCAGAAAGCTGAGGTGGGAGG + Intronic
1028013983 7:85684105-85684127 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1028104105 7:86856883-86856905 CCACAAATATCAGAGCTGGGAGG + Intronic
1028587731 7:92468311-92468333 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1028637724 7:93008369-93008391 TCTCAAGCAGCAGAGCTGGAGGG - Intergenic
1028993385 7:97074790-97074812 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1030394006 7:108962895-108962917 ACTCAAAAGGCTGAGGTGGGAGG - Intergenic
1031250879 7:119378956-119378978 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1031299569 7:120047464-120047486 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1032396312 7:131592579-131592601 CCTGGAACAGCAGAGGTGCTGGG - Intergenic
1032540494 7:132699126-132699148 TCCCAAACAGCAGGGGTGGTGGG - Intronic
1034248764 7:149671695-149671717 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1034249490 7:149676815-149676837 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1034544994 7:151783794-151783816 ACTCAAGCAGCTGAGGTGGGAGG + Intronic
1034614595 7:152404957-152404979 CCTCAGAAGGCTGAGGTGGGAGG - Intronic
1034650848 7:152688867-152688889 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1034657436 7:152740812-152740834 ACTCAAAAGGCTGAGGTGGGGGG - Intergenic
1034707081 7:153155210-153155232 CAGCAAACAGCAGTGGTGGATGG + Intergenic
1034939527 7:155221228-155221250 CCTCAGCCAGCAGAGGTGACAGG + Intergenic
1034965015 7:155385412-155385434 CGGCAAACAGCAGTGGTGGACGG + Intronic
1035138929 7:156737815-156737837 CATCAAACAGGAGAGCTTGGAGG - Intronic
1035999526 8:4584763-4584785 CCTCAGAGAGGAGAGGTGAGAGG - Intronic
1036941953 8:13060232-13060254 ACTCAGAAAGCTGAGGTGGGAGG + Intergenic
1037706675 8:21321371-21321393 CCTCAAGAAGTAGGGGTGGGAGG - Intergenic
1038032856 8:23659858-23659880 ACTCAAGAAGCTGAGGTGGGAGG + Intergenic
1038164765 8:25074873-25074895 ACTCAGGCAGCTGAGGTGGGAGG - Intergenic
1038273558 8:26098357-26098379 ACTCAGAAGGCAGAGGTGGGAGG - Intergenic
1038348803 8:26757519-26757541 CCTGATGGAGCAGAGGTGGGGGG - Intronic
1038876689 8:31558563-31558585 CCTCAAACAGAAGCTGTGGCTGG - Intergenic
1039482418 8:37884494-37884516 CCTCAAGAGGCTGAGGTGGGAGG - Intronic
1039558482 8:38494365-38494387 CCTCAGAAGGCTGAGGTGGGAGG + Intergenic
1039604321 8:38868084-38868106 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1040951953 8:52946325-52946347 ACTCAAAAGGCTGAGGTGGGAGG - Intergenic
1041853548 8:62421478-62421500 CCTCAAAAAGCAAAGCTGTGGGG - Intronic
1041950879 8:63500149-63500171 ACTCAAGAAGCTGAGGTGGGAGG - Intergenic
1042341409 8:67683931-67683953 TCTCAAGCAGCTGAGGTGGGAGG - Intronic
1042917213 8:73887413-73887435 CCTCAAGAGGCTGAGGTGGGAGG - Intergenic
1043852402 8:85229695-85229717 CCTCAGGAAGCTGAGGTGGGAGG + Intronic
1044389961 8:91638536-91638558 ACTCAGAAAGCTGAGGTGGGAGG - Intergenic
1045171009 8:99668245-99668267 ACTCAGAGAGCCGAGGTGGGAGG + Intronic
1045378686 8:101601049-101601071 ACTCAAGAGGCAGAGGTGGGAGG + Intronic
1045664320 8:104468926-104468948 CAGCAAACAGCAGTGGTGGATGG - Intergenic
1045788640 8:105955560-105955582 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1046902422 8:119537559-119537581 ACTCAAAAGGCTGAGGTGGGAGG + Intergenic
1046945986 8:119974768-119974790 CCTCAAAAAAAAAAGGTGGGGGG + Intronic
1047276649 8:123410761-123410783 CAGCAAACAGCAGTGGTGGACGG - Intronic
1048429662 8:134358325-134358347 CCTTAACCAGCAGAGTTAGGAGG - Intergenic
1049632759 8:143667542-143667564 ACTCAAGCAGCTGAGGTGGGAGG + Intergenic
1049810412 8:144565983-144566005 ACTCAGGAAGCAGAGGTGGGAGG + Intronic
1050422629 9:5482596-5482618 ACTCAGGAAGCAGAGGTGGGAGG + Intergenic
1050579256 9:7033654-7033676 CATTACAGAGCAGAGGTGGGGGG - Intronic
1051194196 9:14545517-14545539 TCTCAGAAAGCAGAGGTGAGGGG + Intergenic
1051438149 9:17054491-17054513 CCTCAGGAGGCAGAGGTGGGAGG - Intergenic
1051699196 9:19801422-19801444 CAGCAAACAGCAGTGGTGGACGG + Intergenic
1051818605 9:21138330-21138352 ACTCAGACAGCTGAGGTGGGAGG - Intergenic
1052967427 9:34351094-34351116 TCTCAGAAAGCTGAGGTGGGAGG + Intergenic
1053319257 9:37080438-37080460 CTTCTGACAGCAGAGGCGGGAGG - Intergenic
1053323571 9:37121030-37121052 CTTCTGACAGCAGAGGCGGGAGG - Intronic
1053946177 9:43311929-43311951 CCGCAAAAAGCAGCGGTGGCGGG - Intergenic
1054728233 9:68674310-68674332 CTTCAACCAGCAGAGTAGGGTGG + Intergenic
1055033021 9:71789851-71789873 CCTCCAGAAGCTGAGGTGGGAGG - Intronic
1055372364 9:75613741-75613763 ACTCAAAAGGCTGAGGTGGGAGG - Intergenic
1056705015 9:88944283-88944305 CAGCAAACAGCAGTGGTGGTTGG + Intergenic
1057607865 9:96513910-96513932 CCACTGCCAGCAGAGGTGGGTGG + Intronic
1057750250 9:97787145-97787167 CCTCAAACATTAGAGTTAGGAGG - Intergenic
1058132378 9:101267395-101267417 CTTCAAACAGCAGAGAAGGCTGG + Intronic
1058544559 9:106046590-106046612 ACTCAAAAGGCTGAGGTGGGAGG + Intergenic
1060096969 9:120800056-120800078 ACTCAAAAGGCTGAGGTGGGAGG - Intergenic
1060641991 9:125246609-125246631 ACTCAGAAAGCTGAGGTGGGAGG + Intergenic
1061827026 9:133264864-133264886 ACTCAAAAGGCTGAGGTGGGAGG - Intronic
1061835593 9:133327252-133327274 ACTCAGAAAGCTGAGGTGGGAGG - Intergenic
1061973610 9:134057471-134057493 CCACAAACAGCACAGGTGGTCGG + Intronic
1062502462 9:136857357-136857379 CCTCGAACAGCAGCTGGGGGTGG - Exonic
1203589307 Un_KI270747v1:40487-40509 CCGCAAAAAGCAGCGGTGGCGGG - Intergenic
1186045753 X:5534958-5534980 ACTCAAACAGCATACGTGGAAGG + Intergenic
1186064359 X:5745468-5745490 ACTCAAAAGGCTGAGGTGGGAGG + Intergenic
1186251873 X:7676829-7676851 CCTCCAATAGCAAAGGTGAGAGG + Intergenic
1187498687 X:19819440-19819462 ACTCAAAAGGCTGAGGTGGGAGG - Intronic
1188445646 X:30250608-30250630 CCTAAAACAGGAGAGGAGGAGGG - Exonic
1189448002 X:41099033-41099055 ACTCAAGAGGCAGAGGTGGGAGG - Intronic
1189546918 X:42050980-42051002 ACTCAAATAGCTGGGGTGGGAGG - Intergenic
1189954280 X:46262003-46262025 CAGCAAACAGCAGCGGTGGGCGG + Intergenic
1189954702 X:46265321-46265343 GCTCAAAGAGCAGTGGTGGAGGG + Intergenic
1190121888 X:47667581-47667603 ACTCAAGAAGCTGAGGTGGGAGG - Intergenic
1190850242 X:54233327-54233349 ACTCAAAAGGCTGAGGTGGGAGG + Intronic
1191167488 X:57405562-57405584 CGGCAAACAGCAGTGGTGGATGG + Intronic
1192371994 X:70521965-70521987 ACTCAAAAGGCTGAGGTGGGAGG - Intergenic
1192853931 X:74987161-74987183 CAGCAAACAGCAGTGGTGGACGG + Intergenic
1192960997 X:76130737-76130759 CAGCAAACAGCAGTGGTGGATGG - Intergenic
1193172388 X:78350375-78350397 CAGCAAACAGCAGTGGTGGATGG + Intergenic
1193295496 X:79827570-79827592 CTGCAAACAGCAGTGGTGGAAGG + Intergenic
1195259091 X:103115404-103115426 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1195319737 X:103711826-103711848 CCTGGAGCAGCTGAGGTGGGAGG + Intronic
1195382053 X:104280281-104280303 CCTCAGGAAGCTGAGGTGGGAGG + Intergenic
1195584602 X:106551389-106551411 CAGCAAACAGCAGTGGTGGTCGG - Intergenic
1196287281 X:113897473-113897495 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1196311650 X:114174818-114174840 ACTCAGGAAGCAGAGGTGGGAGG - Intergenic
1197999720 X:132420349-132420371 CGGCAAACAGCAGTGGTGGATGG + Intronic
1198113660 X:133524418-133524440 ACTCAAGAAGCTGAGGTGGGAGG + Intergenic
1200421366 Y:2972759-2972781 CTTCAAACACCAGAGGTTGATGG + Intronic
1201225182 Y:11811722-11811744 CCTCAGAAGGCTGAGGTGGGAGG - Intergenic
1201526707 Y:14944119-14944141 CCTCTAAGAAGAGAGGTGGGAGG + Intergenic
1202098206 Y:21276432-21276454 CTTTAAGAAGCAGAGGTGGGTGG - Intergenic