ID: 1086581794

View in Genome Browser
Species Human (GRCh38)
Location 11:88408371-88408393
Sequence GCATCAGAAGGCCCCTTCAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 121
Summary {0: 1, 1: 0, 2: 3, 3: 8, 4: 109}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1086581794_1086581801 28 Left 1086581794 11:88408371-88408393 CCCTTGAAGGGGCCTTCTGATGC 0: 1
1: 0
2: 3
3: 8
4: 109
Right 1086581801 11:88408422-88408444 ATTTGGCAGGTTTTTCCAGATGG 0: 8
1: 13
2: 10
3: 61
4: 442
1086581794_1086581799 11 Left 1086581794 11:88408371-88408393 CCCTTGAAGGGGCCTTCTGATGC 0: 1
1: 0
2: 3
3: 8
4: 109
Right 1086581799 11:88408405-88408427 CTTCTTGATGTCATCATATTTGG 0: 10
1: 16
2: 16
3: 43
4: 339
1086581794_1086581800 15 Left 1086581794 11:88408371-88408393 CCCTTGAAGGGGCCTTCTGATGC 0: 1
1: 0
2: 3
3: 8
4: 109
Right 1086581800 11:88408409-88408431 TTGATGTCATCATATTTGGCAGG 0: 11
1: 12
2: 12
3: 18
4: 178

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086581794 Original CRISPR GCATCAGAAGGCCCCTTCAA GGG (reversed) Intergenic
901678051 1:10898321-10898343 GGGTCAGAGGGCCCCCTCAAGGG + Intergenic
901878183 1:12179005-12179027 ACATCAGCAGGCCCCTTGGAGGG + Intronic
902070012 1:13726341-13726363 GCAGTAGAAGGGCCCTTCAGAGG + Intronic
902692517 1:18118689-18118711 GCATCAGAAGGCCAATTCCTAGG + Intronic
903657742 1:24959403-24959425 GCCTCAGAAGCCGCCATCAAAGG + Intronic
903876129 1:26474114-26474136 GCCTAAAAAGGCCCCTGCAAAGG + Exonic
904301880 1:29559507-29559529 GCATCTCCAGGCCCTTTCAATGG - Intergenic
904791028 1:33021336-33021358 GCATGAAAAGGGACCTTCAAGGG + Intronic
905251378 1:36650912-36650934 GTATCACAAGGCTCCTTAAAAGG + Intergenic
907089017 1:51707332-51707354 GCACCAGAGGGCCCCCTAAAGGG - Intronic
907660409 1:56387252-56387274 GCATCACAAAGCCCCTTTTATGG + Intergenic
909063882 1:70909494-70909516 GTCTCAGAAGGCCCCATAAAAGG + Intronic
909467640 1:75991181-75991203 GCACCAGAAAGCCTCATCAAAGG - Intergenic
910870580 1:91829443-91829465 GCATCAGAAGACCCATGCACTGG + Intronic
910900460 1:92114994-92115016 GCATCAGAGGGGGCCCTCAAGGG - Intronic
913227656 1:116714026-116714048 GCATCAGAGGGCCCCCTCAAGGG - Intergenic
913514906 1:119596360-119596382 GCATCAGAAGGCCCCCATAAGGG - Intergenic
1063080154 10:2760237-2760259 ACATTAGAAGGCCTCTTTAAGGG + Intergenic
1064592076 10:16904274-16904296 GCAACAGAAAGTCCCTCCAAGGG + Intronic
1068338347 10:55667540-55667562 GCATCGGAGGGCCCGCTCAAGGG - Intergenic
1070749346 10:78954788-78954810 GCAGCAGCAGGCTCCTTCACAGG - Intergenic
1072599894 10:96915762-96915784 GCTTCAAAAGGGCCCTGCAAAGG - Intronic
1072803931 10:98412331-98412353 GCAGCTGAAGTCCTCTTCAAGGG - Intronic
1076144839 10:128109677-128109699 GCTTCAGAAGGTTCCTCCAAAGG + Intronic
1076521880 10:131086422-131086444 GTGTCAGAAGGTGCCTTCAAGGG + Intergenic
1080030572 11:27656461-27656483 GCCTCTGAAGGACCCTTCAGAGG - Exonic
1085038174 11:73311837-73311859 CAATCTGAAGGCCCCTACAAAGG - Intronic
1086581794 11:88408371-88408393 GCATCAGAAGGCCCCTTCAAGGG - Intergenic
1092172920 12:6384579-6384601 GCATATGGAGGCACCTTCAAAGG - Exonic
1092193928 12:6537851-6537873 GCGTCGGAGGGCCCCCTCAAGGG + Exonic
1094855235 12:34399949-34399971 GCATCAGAGGTCCCCTGCAACGG + Intergenic
1096216470 12:49800391-49800413 GCATCACAAGGCCCTGTCTAAGG - Intronic
1104875203 12:132029187-132029209 GCACCAGAAGGCCCTTGCTATGG - Intronic
1105547122 13:21359103-21359125 GTATCGGAGGGCCCCCTCAAGGG + Intergenic
1106388077 13:29307570-29307592 GTGTCAGAGGGCCCCCTCAAGGG + Intronic
1108732435 13:53248690-53248712 TCATCACCAGCCCCCTTCAAAGG - Intergenic
1118872689 14:69756621-69756643 TCATTAGAAGGCTCCTTCCAAGG + Intronic
1124136522 15:27040263-27040285 GCATCTCAAGGGCTCTTCAAGGG - Intronic
1124853534 15:33364419-33364441 GGAACAGAAGGACCCTGCAAAGG - Intronic
1134821419 16:17250604-17250626 ACATCAGAAGACCCATTCATTGG - Intronic
1138198289 16:55070426-55070448 GCATCTGAAGGTATCTTCAAAGG + Intergenic
1141278035 16:82605841-82605863 GCATCAGAGGTCCTCTTCTATGG + Intergenic
1143365949 17:6408633-6408655 GCATCAGAAGCCCCCATCTCCGG - Intronic
1147307458 17:39573818-39573840 GCATCTGCAGGCCCCTTCCCCGG + Intergenic
1148237041 17:45975976-45975998 GCAGCAGAAGGGCTCTTCAGGGG - Intronic
1151935702 17:77259598-77259620 GCTGCAGAAGGCCCCTGCACGGG - Intergenic
1152852244 17:82644262-82644284 GCCACAGAAGGCCCCTGCAGTGG - Intronic
1156474779 18:37398551-37398573 TCAGCAGAAGGCCCCTTTGACGG - Intronic
1156956939 18:42978232-42978254 GGATCAGAAAATCCCTTCAAAGG + Intronic
1158298778 18:56029260-56029282 GCTTCAAAAGGGCCCTTCCACGG - Intergenic
1159579180 18:70216176-70216198 CCAGCTGTAGGCCCCTTCAAGGG - Intergenic
1165431534 19:35775952-35775974 GCCTCAGGAGGCCCCTGCAGGGG - Intronic
1168189571 19:54727818-54727840 GCATCTGTAGGTCCCTGCAAGGG - Exonic
1168201694 19:54819920-54819942 GCATCTGTAGGTCCCTGCAAGGG - Exonic
925418164 2:3688176-3688198 GCATTGGAGGGCCCCCTCAAGGG - Intronic
925832569 2:7910505-7910527 GCATCAGAATGCCCCTGCTCTGG - Intergenic
926378461 2:12259839-12259861 GAATCAGCATGACCCTTCAAAGG + Intergenic
927967488 2:27280437-27280459 GCAGCAGAAGGCACCCTCACTGG - Exonic
934948472 2:98559507-98559529 GCATCAGCAGGAGCCTTGAACGG - Intronic
935800339 2:106689429-106689451 GCAGCACAAGGCCCCATCATGGG + Intergenic
936089761 2:109493953-109493975 GCATCAGAACCTCCCTTCATGGG + Intronic
945377297 2:209094145-209094167 GCCTCAGAAAGCCCCGTCCAAGG - Intergenic
947848297 2:233263348-233263370 GCATCAAAAGTCCCCTCCATAGG + Intronic
948787646 2:240361139-240361161 GCATCTGAAGGCGCCCTCCACGG + Intergenic
1170169317 20:13393465-13393487 GTGTCAGAGGGCCCCCTCAAGGG + Intronic
1173848971 20:46205948-46205970 GCCCCAAAAGGCCCCTGCAAGGG - Intronic
1175722943 20:61298355-61298377 CAATCAGCAGGCCCCTCCAAGGG + Intronic
1178096708 21:29223070-29223092 GCATTGGAGGGCCCCTTCAAGGG + Intronic
1179575113 21:42303093-42303115 GCTTCAGAAGCCTCCTTAAAGGG - Intergenic
951110121 3:18793304-18793326 TAATCAGAAGGGCCCTTAAAAGG + Intergenic
958499840 3:94890986-94891008 TTACCAGAAGGCCCTTTCAAGGG + Intergenic
960120146 3:113940958-113940980 CCATCAGAAGACCTCATCAATGG - Intronic
962673745 3:137736291-137736313 GCCTCAGCAAGCCCCATCAAAGG - Intergenic
964513536 3:157479677-157479699 GCATCAGAATGCCCATGCTAAGG + Intronic
964690492 3:159444266-159444288 TCATCTGAAGGTCACTTCAAGGG + Intronic
965761340 3:172080238-172080260 GCTTCAGAAGATGCCTTCAAGGG - Intronic
968880100 4:3294190-3294212 GCCTCAGAAGGGCCCTGCACAGG - Intronic
970379518 4:15492917-15492939 GCATCAGAGGGCCCCCTCAAGGG - Intronic
974527032 4:63058631-63058653 TCATCATAAGGCCCCTTTGAGGG + Intergenic
976628051 4:87207877-87207899 ACATCGGAGGGCCCCCTCAAGGG + Intronic
977781315 4:100984388-100984410 ACCTCACAAGGCCGCTTCAAAGG + Intergenic
977893194 4:102335643-102335665 GCATCAGAAGTCCTCTGGAAGGG + Intronic
986383311 5:7207900-7207922 GCTTCAGAGGGCCACTGCAATGG + Intergenic
988840765 5:35081486-35081508 GCATCGGAGGGCCCCTTCATAGG + Intronic
990577605 5:57138228-57138250 GAATCAGAGGAGCCCTTCAAGGG - Intergenic
992175340 5:74144113-74144135 GCAGCAGAAGGGCCCTCTAAGGG + Intergenic
997090182 5:130847283-130847305 GCCTCAGAGGGCCCCTGGAAAGG + Intergenic
1007108379 6:39298629-39298651 GCGTTTGAAGGCCCCATCAACGG - Intergenic
1009895737 6:69746636-69746658 GCATTGGAGGGTCCCTTCAAAGG + Intronic
1010036456 6:71330963-71330985 GCATCACAAGGCAGCTTCAGTGG + Intergenic
1010781829 6:79953198-79953220 GCATCAGAGGGCCCCCTCAAAGG - Intergenic
1011071809 6:83393195-83393217 GCGTCAGAGGACCCCCTCAAAGG + Intronic
1015290470 6:131532719-131532741 GAATCAGAAAGCCCCTGCCATGG - Intergenic
1016301294 6:142634857-142634879 GCCTGAGAAGGCCCAGTCAAGGG + Intergenic
1018658691 6:166065082-166065104 GCATCAGAGGGCTCCCTCTAGGG + Intergenic
1020551778 7:9615770-9615792 GCATCAGAGGGCTCCCTCAAGGG + Intergenic
1022481812 7:30749139-30749161 GCAACAGAAGTCCTCTTGAATGG + Intronic
1027352206 7:77323850-77323872 GGATCTGAAGGTCCCATCAATGG + Intronic
1027997068 7:85437639-85437661 GGATCAGAAAGCCTTTTCAACGG + Intergenic
1033026025 7:137773410-137773432 GGATCAGAATACCCCTTCAGAGG - Intronic
1036410650 8:8496987-8497009 CCAGCAGAAGGACCCTTGAAGGG + Intergenic
1036507454 8:9368482-9368504 GCATTAGAAGGGCCCTTCCAAGG + Intergenic
1036622905 8:10438040-10438062 GGATCACAAGGCCCCACCAATGG - Intergenic
1040620183 8:49083391-49083413 GAATTAGAAGGTCCCTTCACTGG + Intergenic
1045641126 8:104252115-104252137 GCAACAGAAGCCCTTTTCAATGG + Intronic
1047743207 8:127823891-127823913 GCCTCAGATAGCCCCTTAAAGGG - Intergenic
1049637542 8:143697084-143697106 GCACCTGAAGGCCCTTCCAACGG - Intronic
1055238585 9:74156154-74156176 GAATCAGAAAACTCCTTCAAGGG + Intergenic
1056881867 9:90402358-90402380 TCATCCTAAGGGCCCTTCAATGG + Intergenic
1057851291 9:98568663-98568685 GCAGCTGAAGGCCACTGCAAAGG - Intronic
1060184059 9:121553096-121553118 GCATCTGAAGGCCGGTGCAAAGG - Intergenic
1061424218 9:130489077-130489099 GCGTCTGAGGGCCCCTTCAAAGG + Intronic
1062315364 9:135964516-135964538 CCATCACAAGGACCCTGCAAGGG + Intergenic
1062612394 9:137380794-137380816 GCACCAGAAGGCCCCCCCGAGGG + Intronic
1189276114 X:39787325-39787347 GCATCGGAGGGCCCCCTCAAGGG - Intergenic
1189349060 X:40263518-40263540 CCATCAGATGCCCCCATCAAAGG - Intergenic
1190181855 X:48199009-48199031 GCATCAGAAGGTAGCTTCATGGG - Intronic
1190191619 X:48281307-48281329 GCATCAGAAGGTAGCTTCATGGG - Intergenic
1190194898 X:48308496-48308518 GCATCAGAAGGTAGCTTCATGGG - Intergenic
1190661335 X:52656698-52656720 GCATCAGAAGGTAGCTTCATGGG - Intronic
1194386528 X:93262399-93262421 GCATCATAAGGCCTCTTTCAAGG + Intergenic