ID: 1086581921

View in Genome Browser
Species Human (GRCh38)
Location 11:88409179-88409201
Sequence TCAACGGATTTGGCCATACT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 69
Summary {0: 1, 1: 0, 2: 5, 3: 11, 4: 52}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1086581921_1086581928 10 Left 1086581921 11:88409179-88409201 CCCAGTATGGCCAAATCCGTTGA 0: 1
1: 0
2: 5
3: 11
4: 52
Right 1086581928 11:88409212-88409234 CACCTTCACCATGGTGTCTCAGG 0: 9
1: 7
2: 15
3: 26
4: 189
1086581921_1086581929 11 Left 1086581921 11:88409179-88409201 CCCAGTATGGCCAAATCCGTTGA 0: 1
1: 0
2: 5
3: 11
4: 52
Right 1086581929 11:88409213-88409235 ACCTTCACCATGGTGTCTCAGGG 0: 9
1: 9
2: 12
3: 22
4: 149
1086581921_1086581933 21 Left 1086581921 11:88409179-88409201 CCCAGTATGGCCAAATCCGTTGA 0: 1
1: 0
2: 5
3: 11
4: 52
Right 1086581933 11:88409223-88409245 TGGTGTCTCAGGGATGAGGCTGG No data
1086581921_1086581931 17 Left 1086581921 11:88409179-88409201 CCCAGTATGGCCAAATCCGTTGA 0: 1
1: 0
2: 5
3: 11
4: 52
Right 1086581931 11:88409219-88409241 ACCATGGTGTCTCAGGGATGAGG No data
1086581921_1086581925 1 Left 1086581921 11:88409179-88409201 CCCAGTATGGCCAAATCCGTTGA 0: 1
1: 0
2: 5
3: 11
4: 52
Right 1086581925 11:88409203-88409225 TTCCACCTTCACCTTCACCATGG 0: 1
1: 0
2: 1
3: 41
4: 279

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086581921 Original CRISPR TCAACGGATTTGGCCATACT GGG (reversed) Intergenic
900390996 1:2433856-2433878 TCCACGGATGTGCCCACACTGGG + Intronic
905264419 1:36741112-36741134 TCTACGGATTTGCCTATTCTGGG + Intergenic
907089138 1:51708102-51708124 TAAACGGATTTGGCTGTATTAGG - Intronic
911121558 1:94302060-94302082 TAAATGGATTTGGCCATACTGGG + Intergenic
911451604 1:98068859-98068881 TCAACTGATTTGGCTCCACTGGG + Intergenic
913496830 1:119435057-119435079 TCAACGGATTTGGCTGTATTGGG - Intergenic
913499963 1:119462977-119462999 TCAATGGATTTGGCTTTATTGGG - Intergenic
913510789 1:119559730-119559752 TCAATGGATTTGTCCCTATTGGG - Intergenic
918121529 1:181545356-181545378 TCAAAGTATTTTGTCATACTTGG + Intronic
1072047103 10:91667738-91667760 TAAATGGATTTGGCCATGTTGGG - Intergenic
1086581921 11:88409179-88409201 TCAACGGATTTGGCCATACTGGG - Intergenic
1089060326 11:115621046-115621068 TCTACGGCTTTGTCCATTCTAGG + Intergenic
1092329085 12:7566385-7566407 TAAATGGATTTGGCCATATTAGG + Intergenic
1096644312 12:53021748-53021770 TCAAGGGATTTGTGCATAATGGG + Intronic
1097615300 12:61878088-61878110 TCAACGAATTTGACTATTCTAGG - Intronic
1100236705 12:92668904-92668926 TCATCTGAGTTGGCAATACTGGG + Intergenic
1101608968 12:106272893-106272915 TCAACAGGTTTGTCCATCCTTGG + Intronic
1109992310 13:70074184-70074206 TTAAGAGATTTGGCCATAGTGGG + Intronic
1110352522 13:74525932-74525954 TGAACAGATTTGTCCATAGTGGG - Intergenic
1112414224 13:99190947-99190969 AAAACAGATTTGGCCATATTGGG - Intergenic
1112512593 13:100023177-100023199 TAAACGTATTTGGCAATATTTGG + Intergenic
1116315779 14:43390152-43390174 TCAAGTGATTTGCCCATCCTGGG + Intergenic
1128036326 15:64529627-64529649 TCAACAGATTTGGTCGTACTGGG - Intronic
1131786178 15:95913465-95913487 TCAAAGGATTTGCACATAATTGG + Intergenic
1131940907 15:97563749-97563771 CCAATGGATTGGGCCACACTGGG + Intergenic
1134264150 16:12678362-12678384 TCAACTGTTTTGGCCATTATAGG + Intronic
1134763636 16:16736373-16736395 TCTATGGATTTGCCCATTCTGGG + Intergenic
1154391733 18:13942404-13942426 TTAACTGATTTGGCCAGGCTCGG - Intergenic
1162590015 19:11585268-11585290 TAAATGGATTTGGCCATATTGGG + Intronic
929098334 2:38285432-38285454 TCAACAGATTTGGCCACATTGGG + Intergenic
931532127 2:63227956-63227978 TCAACAAATTTTGCTATACTTGG - Intronic
936921629 2:117695155-117695177 TCAAAGGATTTCCCCATCCTAGG + Intergenic
1173135932 20:40438861-40438883 TAAACGGCTTTGGCCAGATTTGG - Intergenic
1177277026 21:18925438-18925460 ACAAAGGATTTGGCAATACTTGG - Intergenic
1180123129 21:45767260-45767282 TCTACAGATTTGCCCATGCTGGG + Intronic
1183132063 22:35847166-35847188 TAAACTAATTTGGCCAGACTAGG + Intronic
955678602 3:61476106-61476128 TCATTGGTTTTGGCCATAGTTGG - Intergenic
955931978 3:64066531-64066553 TAAAAGGATTTGCCCATGCTAGG + Intergenic
956011428 3:64835576-64835598 TCTACGGATTTGCCTATTCTAGG + Intergenic
956097210 3:65729613-65729635 TCAAGGAATTTGGCCTTGCTGGG - Intronic
960275583 3:115725912-115725934 TCAACGGATTGGGCAACACAGGG - Intergenic
965151167 3:164977154-164977176 TCAACCTATATGGCCATAATGGG - Intergenic
966529558 3:180960189-180960211 TCAAAGTATTAGGCCAGACTTGG - Intronic
971787290 4:31120763-31120785 TAAAAGGATTTGGCTAAACTAGG - Intronic
977950304 4:102963040-102963062 TCAAGGGGTTTGACCATATTCGG + Intronic
979337528 4:119480397-119480419 TCAACTCATTAGGACATACTTGG + Intergenic
980265065 4:130504306-130504328 TAAACGGATTTGGCCATATCAGG - Intergenic
980812278 4:137897913-137897935 TCAATGGATTTTGCCTTAATAGG - Intergenic
981769677 4:148294018-148294040 CCAAGGGATTTGGCCCTATTGGG + Intronic
986671475 5:10146647-10146669 TCAAGGGATTGTGCCATACTGGG + Intergenic
988419588 5:30989131-30989153 TCAACTACATTGGCCATACTTGG - Intergenic
1000300425 5:159951454-159951476 TCAACGGATTTGGATGTATTGGG - Intronic
1009023329 6:57968626-57968648 TAAACGGATTTGGCCTTACTGGG - Intergenic
1009198901 6:60720159-60720181 TAAACGGATTTGGCCTTACTGGG - Intergenic
1009432058 6:63574586-63574608 TGAAGGGATATGGCCAGACTAGG + Intronic
1015526325 6:134177606-134177628 TCAAAGGATTTGGGGTTACTTGG - Intronic
1015665183 6:135620127-135620149 TCAACGAATTTGGCTATACTGGG - Intergenic
1020551667 7:9615001-9615023 TCAATGGATTTGGCCATATTGGG + Intergenic
1020734379 7:11928635-11928657 TCAAAGGATTTGACCATTTTTGG - Intergenic
1023381110 7:39609621-39609643 TCAACGGATTGGAGCCTACTGGG + Intronic
1024645027 7:51363691-51363713 TCAACAGCTGTGGCCATACTGGG - Intergenic
1028620178 7:92816955-92816977 TCAAGGGATTTGTCTATCCTAGG - Intronic
1032297398 7:130652224-130652246 TCCACAGATGTGGCCTTACTAGG + Intronic
1042358013 8:67850634-67850656 TCTACGAATTTGGCTATTCTAGG + Intergenic
1049343792 8:142127870-142127892 TCAATGCATTTGGCCACACCTGG - Intergenic
1052986797 9:34493823-34493845 CCAATGGATTTGGCCACCCTGGG + Intronic
1188852007 X:35143608-35143630 TCAAGGGATGGTGCCATACTGGG + Intergenic
1189276249 X:39788092-39788114 TCAACAGATTTGGTCGTACTGGG - Intergenic
1189973524 X:46440670-46440692 TCAACGGATTTGGTCGTATTAGG - Intergenic