ID: 1086589571

View in Genome Browser
Species Human (GRCh38)
Location 11:88496100-88496122
Sequence AAGAGCAGGCATAAGTGTTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1086589571_1086589575 4 Left 1086589571 11:88496100-88496122 CCAGAACACTTATGCCTGCTCTT No data
Right 1086589575 11:88496127-88496149 TTAAGGTCCTATCTCTTTCCTGG No data
1086589571_1086589579 23 Left 1086589571 11:88496100-88496122 CCAGAACACTTATGCCTGCTCTT No data
Right 1086589579 11:88496146-88496168 CTGGCTATAGAATGAGGCGCAGG No data
1086589571_1086589577 17 Left 1086589571 11:88496100-88496122 CCAGAACACTTATGCCTGCTCTT No data
Right 1086589577 11:88496140-88496162 TCTTTCCTGGCTATAGAATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086589571 Original CRISPR AAGAGCAGGCATAAGTGTTC TGG (reversed) Intergenic
No off target data available for this crispr