ID: 1086589573

View in Genome Browser
Species Human (GRCh38)
Location 11:88496114-88496136
Sequence AGGACCTTAAGGAGAAGAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1086589573_1086589581 22 Left 1086589573 11:88496114-88496136 CCTGCTCTTCTCCTTAAGGTCCT No data
Right 1086589581 11:88496159-88496181 GAGGCGCAGGATTCAGATGTGGG No data
1086589573_1086589580 21 Left 1086589573 11:88496114-88496136 CCTGCTCTTCTCCTTAAGGTCCT No data
Right 1086589580 11:88496158-88496180 TGAGGCGCAGGATTCAGATGTGG No data
1086589573_1086589579 9 Left 1086589573 11:88496114-88496136 CCTGCTCTTCTCCTTAAGGTCCT No data
Right 1086589579 11:88496146-88496168 CTGGCTATAGAATGAGGCGCAGG No data
1086589573_1086589575 -10 Left 1086589573 11:88496114-88496136 CCTGCTCTTCTCCTTAAGGTCCT No data
Right 1086589575 11:88496127-88496149 TTAAGGTCCTATCTCTTTCCTGG No data
1086589573_1086589577 3 Left 1086589573 11:88496114-88496136 CCTGCTCTTCTCCTTAAGGTCCT No data
Right 1086589577 11:88496140-88496162 TCTTTCCTGGCTATAGAATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086589573 Original CRISPR AGGACCTTAAGGAGAAGAGC AGG (reversed) Intergenic
No off target data available for this crispr