ID: 1086589574

View in Genome Browser
Species Human (GRCh38)
Location 11:88496125-88496147
Sequence AGGAAAGAGATAGGACCTTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1086589574_1086589582 20 Left 1086589574 11:88496125-88496147 CCTTAAGGTCCTATCTCTTTCCT No data
Right 1086589582 11:88496168-88496190 GATTCAGATGTGGGCTGTTTTGG No data
1086589574_1086589583 23 Left 1086589574 11:88496125-88496147 CCTTAAGGTCCTATCTCTTTCCT No data
Right 1086589583 11:88496171-88496193 TCAGATGTGGGCTGTTTTGGAGG No data
1086589574_1086589579 -2 Left 1086589574 11:88496125-88496147 CCTTAAGGTCCTATCTCTTTCCT No data
Right 1086589579 11:88496146-88496168 CTGGCTATAGAATGAGGCGCAGG No data
1086589574_1086589577 -8 Left 1086589574 11:88496125-88496147 CCTTAAGGTCCTATCTCTTTCCT No data
Right 1086589577 11:88496140-88496162 TCTTTCCTGGCTATAGAATGAGG No data
1086589574_1086589581 11 Left 1086589574 11:88496125-88496147 CCTTAAGGTCCTATCTCTTTCCT No data
Right 1086589581 11:88496159-88496181 GAGGCGCAGGATTCAGATGTGGG No data
1086589574_1086589580 10 Left 1086589574 11:88496125-88496147 CCTTAAGGTCCTATCTCTTTCCT No data
Right 1086589580 11:88496158-88496180 TGAGGCGCAGGATTCAGATGTGG No data
1086589574_1086589584 24 Left 1086589574 11:88496125-88496147 CCTTAAGGTCCTATCTCTTTCCT No data
Right 1086589584 11:88496172-88496194 CAGATGTGGGCTGTTTTGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086589574 Original CRISPR AGGAAAGAGATAGGACCTTA AGG (reversed) Intergenic
No off target data available for this crispr