ID: 1086589579

View in Genome Browser
Species Human (GRCh38)
Location 11:88496146-88496168
Sequence CTGGCTATAGAATGAGGCGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1086589573_1086589579 9 Left 1086589573 11:88496114-88496136 CCTGCTCTTCTCCTTAAGGTCCT No data
Right 1086589579 11:88496146-88496168 CTGGCTATAGAATGAGGCGCAGG No data
1086589574_1086589579 -2 Left 1086589574 11:88496125-88496147 CCTTAAGGTCCTATCTCTTTCCT No data
Right 1086589579 11:88496146-88496168 CTGGCTATAGAATGAGGCGCAGG No data
1086589571_1086589579 23 Left 1086589571 11:88496100-88496122 CCAGAACACTTATGCCTGCTCTT No data
Right 1086589579 11:88496146-88496168 CTGGCTATAGAATGAGGCGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086589579 Original CRISPR CTGGCTATAGAATGAGGCGC AGG Intergenic
No off target data available for this crispr