ID: 1086590351

View in Genome Browser
Species Human (GRCh38)
Location 11:88508557-88508579
Sequence AGCACGCCGGCCTGCGCGTG CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 67
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 65}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1086590351_1086590356 3 Left 1086590351 11:88508557-88508579 CCGCACGCGCAGGCCGGCGTGCT 0: 1
1: 0
2: 0
3: 1
4: 65
Right 1086590356 11:88508583-88508605 CAGGGACATTCACAACGACGAGG 0: 1
1: 0
2: 0
3: 3
4: 55

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086590351 Original CRISPR AGCACGCCGGCCTGCGCGTG CGG (reversed) Exonic