ID: 1086591239

View in Genome Browser
Species Human (GRCh38)
Location 11:88516529-88516551
Sequence TGGGAAAATAATTCCTGTTT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 433
Summary {0: 1, 1: 0, 2: 2, 3: 38, 4: 392}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1086591232_1086591239 27 Left 1086591232 11:88516479-88516501 CCTGAGGGACTGTAAGATAAAAG 0: 1
1: 0
2: 2
3: 11
4: 193
Right 1086591239 11:88516529-88516551 TGGGAAAATAATTCCTGTTTAGG 0: 1
1: 0
2: 2
3: 38
4: 392
1086591236_1086591239 -1 Left 1086591236 11:88516507-88516529 CCAGGATGTTTAGAATGGTTGCT 0: 1
1: 0
2: 0
3: 6
4: 121
Right 1086591239 11:88516529-88516551 TGGGAAAATAATTCCTGTTTAGG 0: 1
1: 0
2: 2
3: 38
4: 392
1086591235_1086591239 0 Left 1086591235 11:88516506-88516528 CCCAGGATGTTTAGAATGGTTGC 0: 1
1: 0
2: 0
3: 15
4: 133
Right 1086591239 11:88516529-88516551 TGGGAAAATAATTCCTGTTTAGG 0: 1
1: 0
2: 2
3: 38
4: 392

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086591239 Original CRISPR TGGGAAAATAATTCCTGTTT AGG Intronic
900343154 1:2198148-2198170 TTGGAAAATAATTTCTGGTTGGG + Intronic
901431649 1:9218895-9218917 TGGGGACAAAATTTCTGTTTTGG - Intergenic
903295991 1:22343304-22343326 TGGGAAAATAATCCCTTGCTAGG - Intergenic
904427131 1:30435764-30435786 TGGGACAATTATTCCTGTGTGGG + Intergenic
904554988 1:31355454-31355476 TGGGATAATAATTCCTGTTCTGG - Intronic
904817807 1:33219059-33219081 AGGGGAAATAATTTGTGTTTGGG - Intergenic
905507005 1:38487937-38487959 AGGGTCAATAATTCCTGTGTGGG - Intergenic
906163174 1:43666229-43666251 TGGGTAATGAAATCCTGTTTGGG - Intronic
906911126 1:49952030-49952052 TGGGTAAAGAGTTTCTGTTTGGG + Intronic
907245973 1:53109459-53109481 TGGAAAATGAATTCCTGTCTTGG + Intronic
908150996 1:61302870-61302892 TGGGAAAATAATTTCAGCATAGG + Intronic
909268903 1:73598400-73598422 TGCAAAAATAATTGCAGTTTTGG - Intergenic
909412233 1:75367850-75367872 TGGGAAAAAAATGCCTTTGTGGG - Intronic
909879166 1:80850773-80850795 GAGGAAAATAACTCCTGTGTTGG - Intergenic
909893995 1:81043031-81043053 TGCAAAAATAATTGCGGTTTTGG - Intergenic
910084333 1:83381565-83381587 TGGGAAAATCATTCATGCTCTGG + Intergenic
910768440 1:90806655-90806677 TGGTAAAATAATTTCTCTTGAGG + Intergenic
912448474 1:109755263-109755285 TGGGTACAGAATTTCTGTTTGGG + Intronic
914724387 1:150315382-150315404 TGGGTACAGAGTTCCTGTTTTGG - Intergenic
914725710 1:150325654-150325676 TGGGAATAAAATTCCAGTGTTGG + Intronic
916870562 1:168910252-168910274 TGCAAAAGTAATTACTGTTTTGG - Intergenic
916953159 1:169802396-169802418 TGGAAAATAAATTTCTGTTTGGG + Intronic
917613217 1:176711044-176711066 TGGGAAAATAATAGCTTTTCTGG + Intronic
918203603 1:182289788-182289810 TGGGAAAATACTACCTTTCTAGG + Intergenic
918305711 1:183244148-183244170 TGGGAAAGTATTTACTTTTTCGG + Exonic
918656778 1:187036704-187036726 TGAGTAAATATTTCCTGTTGGGG + Intergenic
918665819 1:187149436-187149458 TGGAAAAATATTTTATGTTTAGG - Intergenic
919350025 1:196439632-196439654 TAGGAAAATATTTCCCTTTTGGG + Intronic
921681187 1:218033710-218033732 TTTTAAAATAATTCCTTTTTGGG + Intergenic
922098906 1:222465839-222465861 TGGGAAAAGAAATCCTGGGTTGG - Intergenic
924292961 1:242556777-242556799 TGTGAAAGTAATTCCAGTTTTGG - Intergenic
924372468 1:243367015-243367037 TAATAAAATAATTCCAGTTTAGG - Intronic
924872613 1:248065094-248065116 TTGGACAATAATTCCTCTTGGGG + Intronic
1063846144 10:10128738-10128760 TTTTAAAATAATTCTTGTTTTGG + Intergenic
1064029768 10:11876355-11876377 GGGGAAAATAATCTCTGCTTGGG + Intergenic
1064045386 10:12009579-12009601 TAGGAAAATAATCCCTGATAGGG + Intronic
1064448800 10:15422756-15422778 TGGGTACAGAATTTCTGTTTGGG + Intergenic
1064983500 10:21187434-21187456 TGGTAAAATAATTTCTTTTGAGG + Intergenic
1066557415 10:36629646-36629668 TGGGAGAATAAATCCTTTTCCGG + Intergenic
1067956749 10:50799547-50799569 TGGGAAAATAATCTTTGGTTTGG - Exonic
1068417753 10:56746058-56746080 AGGAAAAATAATTCTAGTTTTGG - Intergenic
1068813192 10:61279924-61279946 TGAGAAAATAATTTCCCTTTTGG + Intergenic
1069978936 10:72238762-72238784 TGGGAAAACAACTCCTCCTTGGG - Intergenic
1070138381 10:73715700-73715722 TGGGAAAATATATCTTGTTTGGG + Intergenic
1071769154 10:88705060-88705082 TGGAAAGATAGTTCATGTTTTGG - Intergenic
1072065752 10:91869684-91869706 TGGGAAGATAATTACTTGTTGGG + Intergenic
1073759086 10:106611354-106611376 GTGGATAATAATTCCTTTTTGGG + Intronic
1073871936 10:107875208-107875230 TGAGAAAAAAATTTCTGTCTAGG + Intergenic
1073999861 10:109359921-109359943 TAGGAACATAATTGCTGTTTTGG - Intergenic
1074014010 10:109514757-109514779 TAGGAAAATATTTGGTGTTTTGG + Intergenic
1074040375 10:109782325-109782347 TGGGAAAACAGGTGCTGTTTAGG - Intergenic
1074177405 10:111022987-111023009 TGGTAAAATAATTTCTCTTGAGG - Intergenic
1076236498 10:128867620-128867642 TTGGAAAATATTTTATGTTTAGG + Intergenic
1076406776 10:130217471-130217493 TGGGAACAGAGTTCCAGTTTGGG - Intergenic
1077577962 11:3398652-3398674 TGTGTAAAGTATTCCTGTTTAGG + Intergenic
1077852698 11:6089561-6089583 TGCAAAAGTAATTGCTGTTTTGG - Intergenic
1078060283 11:8038920-8038942 TGGGAACAAAATCCCTGTCTCGG - Exonic
1078810293 11:14754515-14754537 TGGAAAAATAAATAGTGTTTTGG + Intronic
1079016072 11:16870036-16870058 TGGGAAAACACATCCTGCTTGGG + Intronic
1081491461 11:43572608-43572630 GGGAAAAATAATAACTGTTTTGG + Intronic
1081821888 11:46006270-46006292 TATTAAAATAATTCTTGTTTGGG - Intronic
1082041438 11:47688633-47688655 TGGAAAAATAATACCTGCCTTGG - Intronic
1082292839 11:50400375-50400397 TGGGAAAAGAATTCCATTTCTGG + Intergenic
1082763183 11:57146039-57146061 GGGGAAAATAACCCCTGATTAGG - Intergenic
1083427944 11:62598712-62598734 AGGGAAAATATTTCCTATCTTGG + Intronic
1083432295 11:62620321-62620343 TGGGAAAATAGTTCTTTTTCAGG - Intronic
1084231903 11:67759553-67759575 TGTGTAAAGTATTCCTGTTTAGG + Intergenic
1084368738 11:68722287-68722309 TGGGTATAGAATTTCTGTTTGGG + Intronic
1084449657 11:69228673-69228695 TGACAAAAGAATTCCTGTTTTGG - Intergenic
1085941620 11:81212442-81212464 TGGGAAAATAATACCTGAATGGG + Intergenic
1086167092 11:83791449-83791471 TGGAAAGATAATTCCTAATTTGG - Intronic
1086591239 11:88516529-88516551 TGGGAAAATAATTCCTGTTTAGG + Intronic
1087528761 11:99352675-99352697 TGGGAAGATAATGCCTGCTAGGG - Intronic
1087705663 11:101488785-101488807 TTACAAAATAATTCCTGTTTGGG - Intronic
1088767492 11:112997891-112997913 TGGGAAAAGAATCACTTTTTAGG - Intronic
1088781810 11:113142195-113142217 TGGGAATTTGATTCCTGTGTTGG + Intronic
1089271468 11:117304391-117304413 TGAAAAAATGATTCTTGTTTGGG + Intronic
1089476938 11:118771718-118771740 TGGGCAAACTAATCCTGTTTAGG - Intronic
1090144743 11:124309828-124309850 TAGGAAAATGAGTCCTGATTTGG - Exonic
1093440525 12:19190320-19190342 TGGATAAATATTTCCTTTTTTGG + Intronic
1093888454 12:24490548-24490570 GTGGAAAAAAATTGCTGTTTGGG - Intergenic
1093975793 12:25420602-25420624 TGGGGAAAAAAATCCTCTTTGGG - Intronic
1094215236 12:27933680-27933702 TGGGAAAAGATATACTGTTTAGG - Intergenic
1094223072 12:28015390-28015412 GGGGAAAATAATTTATGTTATGG - Intergenic
1094245795 12:28291026-28291048 TGCAAAAGTAATTTCTGTTTTGG + Intronic
1095723061 12:45422336-45422358 TCTCAAAACAATTCCTGTTTTGG - Intronic
1096028455 12:48389018-48389040 TGGGAAAATCTTTCTTGGTTTGG + Intergenic
1097830479 12:64219364-64219386 AGAGAGAATAATACCTGTTTGGG - Intronic
1098471648 12:70851987-70852009 TGGGAAAACTACTCATGTTTAGG + Intronic
1098904635 12:76149398-76149420 TGTGGAAAGAATTCCTCTTTTGG + Intergenic
1099136574 12:78911340-78911362 AGAGAAAATAATTTGTGTTTAGG + Intronic
1099509969 12:83522890-83522912 TTTTAGAATAATTCCTGTTTGGG - Intergenic
1099881298 12:88469968-88469990 TGGAAAAATAATTCTAGATTGGG - Intergenic
1100615041 12:96224666-96224688 GGGCAAAATTATTGCTGTTTAGG + Intronic
1100691894 12:97047225-97047247 TTGGAAATGAATTCCTCTTTTGG + Intergenic
1100812984 12:98358352-98358374 TGCAAAAGTAATTGCTGTTTTGG - Intergenic
1101450029 12:104767669-104767691 AGGCAAAATCATTCCTGGTTGGG - Intergenic
1101638174 12:106564874-106564896 TGGGAGAAAAATTCCTGTGAAGG + Intronic
1102601426 12:114033589-114033611 TGGGAATTTGATTTCTGTTTGGG - Intergenic
1103127896 12:118440224-118440246 TGGGTACAGAATTTCTGTTTGGG + Intergenic
1106091051 13:26594331-26594353 TGGAAAAATAATTACACTTTTGG - Intronic
1106692722 13:32135642-32135664 TGGGAAAATAATTCTTGGGAAGG + Intronic
1108089370 13:46830841-46830863 TGGGAAAATATTTTATGCTTTGG + Intergenic
1108768235 13:53662266-53662288 TGGGAAAATAATATCTGATATGG + Intergenic
1109866855 13:68275759-68275781 TATGCAATTAATTCCTGTTTGGG - Intergenic
1110241058 13:73267394-73267416 TGAGAAAACATTTGCTGTTTCGG + Intergenic
1110979460 13:81877175-81877197 GTGAAAAAAAATTCCTGTTTTGG + Intergenic
1112577862 13:100653026-100653048 TGCAAAAATAATTCCGGTTAAGG - Intronic
1114397705 14:22381816-22381838 TGGGAATATAATTCTTTTTATGG - Intergenic
1114845758 14:26319845-26319867 AGAGAAAATAAGTCCTGTTTGGG + Intergenic
1115086126 14:29517020-29517042 TGGGATAACATTGCCTGTTTTGG - Intergenic
1115148011 14:30248919-30248941 TGGAAAAATAAATCCTTTGTGGG - Intergenic
1116251924 14:42496852-42496874 TGGTAAAATAATTTTTGTTCTGG + Intergenic
1116525043 14:45893883-45893905 TGTGAAATTAATTACTGTCTTGG + Intergenic
1116607437 14:47019465-47019487 TGAGAAAGTAATTGCGGTTTTGG - Intronic
1116643786 14:47500275-47500297 TAGGGAAAGAATTCCTGTTACGG - Intronic
1117253770 14:53957861-53957883 TGTGAAATTAGTTCCTGTTTGGG - Intronic
1117327837 14:54685225-54685247 TGGGAACAGAGTTTCTGTTTGGG - Intronic
1117502387 14:56366266-56366288 TGGGAAAATCATGCTTGTTGTGG + Intergenic
1117521497 14:56556047-56556069 TAGGTAAATACTTCTTGTTTGGG - Intronic
1121032409 14:90670377-90670399 TGGGTACAGAATTTCTGTTTGGG + Intronic
1121133032 14:91466710-91466732 TGGGAAAATAAACCCTTGTTAGG - Intronic
1122741615 14:103874920-103874942 TCAAAAAATACTTCCTGTTTGGG - Intergenic
1123725209 15:23094568-23094590 TGGGCAAATAATTTATTTTTGGG - Intergenic
1123800609 15:23816023-23816045 AGGGAAAATAAATCATATTTAGG - Intergenic
1125309359 15:38361507-38361529 GGGGAAAATCAGTTCTGTTTTGG - Intergenic
1126478729 15:49094269-49094291 TGGGAAAAGAAATCCAGATTAGG + Intergenic
1127191046 15:56530937-56530959 ATGGAAAATAATTCCTCCTTAGG - Intergenic
1128165424 15:65460125-65460147 TGGGTACAGAATTTCTGTTTGGG - Intronic
1128312264 15:66638377-66638399 AGGGCAAATAATTCAAGTTTTGG + Intronic
1128826736 15:70725161-70725183 GGGAAAAATAATTGCTGTTTTGG - Intronic
1132395895 15:101474236-101474258 TGGAAAAATAAGTCCATTTTTGG - Intronic
1133554157 16:6888876-6888898 TGCTAAAATAATTCTTTTTTGGG - Intronic
1133855861 16:9548735-9548757 TGGGAAATTAAGTACAGTTTAGG - Intergenic
1135230672 16:20703820-20703842 TAGGACAATAATTCCAGTTCTGG - Intronic
1135623630 16:23976805-23976827 TGGGGACATCCTTCCTGTTTGGG - Intronic
1137633510 16:49965687-49965709 TTGAAAATTAATTACTGTTTTGG + Intergenic
1138765327 16:59595423-59595445 AGGGAAATTAATTGCTGTGTAGG - Intergenic
1138950834 16:61910763-61910785 TTGGAAAGTAATTCCAGATTGGG - Intronic
1139120812 16:64014248-64014270 TGGAAAGAGATTTCCTGTTTCGG - Intergenic
1139628189 16:68208742-68208764 TAAGAAAACAATTCTTGTTTTGG - Intronic
1140117148 16:72052017-72052039 TGGGTACAGAGTTCCTGTTTGGG - Intronic
1140880321 16:79192275-79192297 TGCGAAAATAACAGCTGTTTGGG - Intronic
1140959646 16:79899727-79899749 TGGGAACTTAAGTCCTGTTGTGG + Intergenic
1141633221 16:85300411-85300433 TGGGTACAGAATTTCTGTTTGGG - Intergenic
1141645783 16:85366849-85366871 TGGGAAAGAAATTCCAGTTTAGG - Intergenic
1141800723 16:86307054-86307076 TGGGAAAAGGATTCCTACTTTGG + Intergenic
1143589238 17:7871020-7871042 TAGAAAAATAATTTCTGGTTGGG - Intronic
1144200506 17:12937238-12937260 GGGTAAAATAATTTCTCTTTAGG + Intronic
1147115239 17:38294367-38294389 AGTAAAAATAATTCATGTTTTGG + Intergenic
1148802530 17:50240352-50240374 TGGTAAAATAGTTCCTCTTGAGG + Intergenic
1148963544 17:51414014-51414036 GAGGAAAATATTTCCAGTTTAGG + Intergenic
1149191271 17:54066009-54066031 TGGGAGAATATTTTCAGTTTAGG - Intergenic
1150890785 17:69146941-69146963 TGGTTACAGAATTCCTGTTTGGG - Intergenic
1152773340 17:82184462-82184484 TGGGAAATTTATTCCATTTTGGG - Intronic
1153732227 18:8026045-8026067 TGGGAAAACATTTACTCTTTGGG - Intronic
1155111809 18:22723082-22723104 TGGGAAAATATTAACTCTTTTGG - Intergenic
1155243312 18:23883945-23883967 TGGTAAGAGAATGCCTGTTTAGG - Intronic
1155354252 18:24936222-24936244 TGGAAAAATAATTGGTGGTTTGG - Intergenic
1155748787 18:29393971-29393993 TGCAAAAATAATTGCAGTTTTGG + Intergenic
1155944719 18:31835511-31835533 TGGGAAAAAATTTCATGGTTTGG - Intronic
1156381049 18:36561675-36561697 TGGGTATATAATTTCTGTTTGGG - Intronic
1156394035 18:36681934-36681956 TGGGAAAAGCATTTCTTTTTGGG - Intronic
1156616681 18:38794197-38794219 TAGGCAAACAAATCCTGTTTTGG - Intergenic
1157730357 18:49998870-49998892 TGGGTAAATAATTTCTGTTTGGG + Intronic
1158613638 18:58966251-58966273 TTGGAGAATAATTTCAGTTTAGG + Intronic
1158913727 18:62097581-62097603 TTAGAAAATAATTCATTTTTGGG - Intronic
1160223796 18:76997074-76997096 TGGGAAAATATAGCCTCTTTTGG + Intronic
926405908 2:12552365-12552387 TGCAAAAATAATTGCTGTTTCGG + Intergenic
928487197 2:31744794-31744816 TGAGAAAATAATTGCTGAGTGGG + Intergenic
928599910 2:32894447-32894469 TGTGAAAATCCTTTCTGTTTGGG + Intergenic
929494099 2:42424454-42424476 TGAGAAGATAATTAATGTTTTGG - Intronic
929979988 2:46669247-46669269 TGTCAAAACAAATCCTGTTTTGG + Intergenic
931646148 2:64423908-64423930 TGAGAAAATAACTCCAGTCTAGG - Intergenic
933032105 2:77341696-77341718 TGGTAAAATAATTTCTTTTTGGG + Intronic
933099890 2:78241355-78241377 TGGGTAAAGAATTTCTGTTTTGG - Intergenic
933207329 2:79522090-79522112 GTAGAAAATAATTACTGTTTTGG - Intronic
934952723 2:98589542-98589564 TGGGAAAATAATTCATATAAAGG - Exonic
935087047 2:99858243-99858265 TGAATAAATAATTGCTGTTTTGG + Intronic
935601690 2:104928639-104928661 TGAGAAAATAATTTATTTTTGGG + Intergenic
937114406 2:119394217-119394239 TGGTAAAATAATTCCCATTAAGG - Intergenic
937205300 2:120232638-120232660 TGGGAAAGTTATGGCTGTTTGGG - Intergenic
937255215 2:120550639-120550661 TTGCAAAATAATGCCTGTTTAGG + Intergenic
938223569 2:129594858-129594880 TGGGTACAGAATTTCTGTTTGGG - Intergenic
939262326 2:139826612-139826634 TGTGCAAATAATTTCTATTTTGG - Intergenic
939644825 2:144684877-144684899 TGGGAAAATGGTTACTGTATTGG + Intergenic
939682278 2:145152526-145152548 TGGGAAAGTAATTGCGATTTTGG - Intergenic
939780660 2:146443380-146443402 TGGGAAAATTGTACTTGTTTAGG - Intergenic
940297565 2:152143834-152143856 TGGTGAAATAATTATTGTTTTGG - Exonic
940518150 2:154707599-154707621 TGGGAAAATATATCTTCTTTGGG + Intronic
940535086 2:154931062-154931084 TGGTAAAATAATTTATGTCTTGG + Intergenic
941015205 2:160348165-160348187 TGGGAAAATAAATCCAGTATTGG - Intronic
941145187 2:161835356-161835378 AGGGAAAATAATGCATGATTTGG - Intronic
942787770 2:179720017-179720039 TGTGAAAACAACTCCTGATTTGG - Intronic
942980231 2:182071791-182071813 TGCTCAAATAGTTCCTGTTTTGG + Intronic
943143035 2:184006782-184006804 ATGCAAAATAATTGCTGTTTTGG + Intergenic
943570299 2:189565746-189565768 TGGAAAAATATTTGTTGTTTGGG + Intronic
944075275 2:195722621-195722643 AGGGAAAATCATTCCTCTATAGG + Intronic
944444759 2:199778099-199778121 TGGGACCAGACTTCCTGTTTTGG - Intronic
944492343 2:200270491-200270513 TGCAAAAATAATTGCGGTTTTGG - Intergenic
945565992 2:211400199-211400221 GGGGATAATAATGCCTGTGTTGG + Intronic
946061032 2:216941820-216941842 GGGAGAAAGAATTCCTGTTTAGG - Intergenic
946955584 2:224926679-224926701 AAGGAAAATACTTCCTGCTTTGG - Intronic
1169162596 20:3394653-3394675 TGGAATAGTCATTCCTGTTTGGG - Intronic
1170363899 20:15579298-15579320 TGAGAAAAGAATTACTCTTTGGG - Intronic
1172942347 20:38663193-38663215 TGGGTACAGAATTTCTGTTTGGG - Intergenic
1172997407 20:39081461-39081483 GGGCAAAATAATTCTTTTTTGGG + Intergenic
1173109797 20:40176007-40176029 TGGAAGAGTAATTCCTTTTTAGG + Intergenic
1173229905 20:41186117-41186139 TGGATATATAATTTCTGTTTAGG - Intronic
1173281220 20:41629904-41629926 TTGGAAAATAATTTATGATTAGG - Intergenic
1173403506 20:42745263-42745285 TGGGAAGATACTTCCTCTGTGGG - Intronic
1174846008 20:53944007-53944029 TGGGAAAACAATTGCTTTTGAGG - Exonic
1175047054 20:56116839-56116861 TGCAAAAGTAATTGCTGTTTGGG - Intergenic
1176327899 21:5518251-5518273 GAGGAAAATAATAGCTGTTTTGG - Intergenic
1176399858 21:6302700-6302722 GAGGAAAATAATAGCTGTTTTGG + Intergenic
1176437299 21:6686404-6686426 GAGGAAAATAATAGCTGTTTTGG - Intergenic
1176461561 21:7013474-7013496 GAGGAAAATAATAGCTGTTTTGG - Intergenic
1176485122 21:7395252-7395274 GAGGAAAATAATAGCTGTTTTGG - Intergenic
1176666661 21:9693877-9693899 TGGTAATATATTTCCTGTTCTGG + Intergenic
1177168554 21:17629909-17629931 AGGGAAAATAGTTTCTGTTTAGG + Intergenic
1177374913 21:20257680-20257702 TGTGAACATAATTGCTGTTACGG - Intergenic
1177594246 21:23214627-23214649 TGGTAAAATAATTCATTCTTAGG - Intergenic
1177628383 21:23695429-23695451 TAGAAAAATAATTCCTGATCTGG - Intergenic
1177921399 21:27156858-27156880 TGCAAAAATAATTGCGGTTTTGG + Intergenic
1178422090 21:32451188-32451210 TGTGTAAAGTATTCCTGTTTAGG - Intronic
1178920217 21:36733860-36733882 GGGGAAAAAAATCCCTGCTTCGG - Intronic
1179953754 21:44726760-44726782 TGGGAAGATCTTTCCTGTGTGGG + Intergenic
1180676816 22:17592077-17592099 TGGGAAAATACTTCTTTTCTAGG + Intergenic
1180714396 22:17861588-17861610 GGGGAAAATAATCCCTTTTGGGG + Intronic
1181843482 22:25686251-25686273 TGTGAAATTCCTTCCTGTTTCGG - Intronic
1182665644 22:31957573-31957595 TGGGTAAATAAATGCTGCTTTGG + Exonic
1184902327 22:47455012-47455034 TGTGAAAATAATGCCTCATTGGG + Intergenic
1184964146 22:47955213-47955235 TGGGAAAATAATTTATATTTAGG + Intergenic
949481063 3:4493992-4494014 TGGGAGAATAATGCATGTGTAGG + Intronic
951154722 3:19336990-19337012 AGAGAAAATAATTCCTGCCTAGG + Intronic
951810897 3:26698530-26698552 GGGGAAGATAAGTCCTTTTTTGG - Intronic
954664167 3:52242524-52242546 TGGGAAAAGAATGACAGTTTTGG + Intergenic
955993779 3:64656879-64656901 TGTGAAAAGCAATCCTGTTTGGG - Intronic
956053699 3:65276409-65276431 TGGGAAATAAATGCCAGTTTGGG - Intergenic
957048541 3:75394856-75394878 TGTGTAAAGTATTCCTGTTTAGG + Intergenic
957736063 3:84204281-84204303 TGGTAAAACAATTTCTATTTTGG - Intergenic
957794224 3:84982185-84982207 TGAGAAAATAATTCTTTTTACGG + Intronic
957944678 3:87048144-87048166 TGGCAAACTCATTCCTGTTAGGG - Intergenic
959137918 3:102448171-102448193 GGGGAAAAACATTGCTGTTTTGG + Intronic
959209652 3:103361360-103361382 GGGGAAAATAATTCAGTTTTAGG - Intergenic
959372215 3:105541447-105541469 TGGGCAAATAATTAATATTTTGG - Intronic
959693818 3:109227970-109227992 TGAAAAATAAATTCCTGTTTAGG - Intergenic
959916057 3:111817593-111817615 TGGGAAAATAATTTTGGTTAAGG - Intronic
960209693 3:114947317-114947339 TGGTATAATAATTTCTTTTTGGG - Intronic
962568549 3:136689113-136689135 TGAGAAAATTATTCCCATTTGGG - Intronic
962586370 3:136846288-136846310 TTGGGAAATAGTTCCTCTTTTGG + Intronic
963344994 3:144084919-144084941 TGGGAAAACAATAACAGTTTAGG - Intergenic
964423098 3:156525208-156525230 TGTGATAATAATTCCTCTTTGGG - Intronic
964824223 3:160807784-160807806 AGGTAAAAGAATTCCTGCTTGGG + Intronic
964907530 3:161736091-161736113 TGTGAAAGTAATTGCAGTTTTGG - Intergenic
965839016 3:172881897-172881919 AGGGAGAATAATACCTGTTATGG + Intergenic
966177121 3:177150697-177150719 TGGAAAAATATGTCCTGTGTAGG + Intronic
966230816 3:177649406-177649428 GGGGAAACAAATTCCTGGTTTGG - Intergenic
967024208 3:185549430-185549452 TGAGGAAATAATTCTGGTTTTGG + Intronic
967347169 3:188470445-188470467 TGGGAAAATATTTCCTGAGTGGG - Intronic
967382946 3:188880845-188880867 TGGGAATAGCATTCGTGTTTGGG - Exonic
968993010 4:3927313-3927335 TGTGTAAAGTATTCCTGTTTAGG + Intergenic
969112331 4:4851792-4851814 CGGGAAAATGACTCCCGTTTGGG + Intergenic
969822461 4:9731049-9731071 TGTGTAAAGTATTCCTGTTTAGG - Intergenic
970383301 4:15530441-15530463 TGTGAGAATAATTTTTGTTTTGG + Intronic
972074834 4:35074133-35074155 TGGGAATAGAGTTTCTGTTTGGG - Intergenic
972132467 4:35855368-35855390 AGGGACCATAATTCTTGTTTTGG - Intergenic
972462957 4:39323239-39323261 TGGAAAAGTTATTCATGTTTTGG + Intronic
972772449 4:42210146-42210168 TGTGAAAATAAGTAATGTTTAGG - Intergenic
972985364 4:44756849-44756871 TGTGGAAATTATTCCAGTTTTGG - Intergenic
973952244 4:56027884-56027906 TGGGTACAGAATTTCTGTTTGGG - Intronic
974040378 4:56852299-56852321 TGGGAAAGTAATTCTGGGTTTGG - Intergenic
974627506 4:64443444-64443466 TGGCAAAATGCTTCCTCTTTGGG + Intergenic
974911225 4:68123296-68123318 TGGGCAACTAATTCTTGCTTAGG - Intronic
975786385 4:77893147-77893169 TGGTAAAATATTTCTTGCTTGGG + Intronic
975875829 4:78835974-78835996 TGGGAAAATAAACACTGATTTGG - Intronic
975903633 4:79183259-79183281 TGGGAAAAAAGTTTCTGTTTTGG + Intergenic
975927496 4:79476344-79476366 TGGGAAAATAACTCACTTTTTGG - Intergenic
976612625 4:87045653-87045675 TGAGAAAGTAAATGCTGTTTTGG + Intronic
976693863 4:87897562-87897584 TGGGAAAATACTTTCTGGGTAGG - Intergenic
978512074 4:109531154-109531176 AGGGAAAATAATACCTCTTTAGG - Intronic
978673018 4:111273943-111273965 TGTGAAAATAATTCCTCTACTGG + Intergenic
978775391 4:112500624-112500646 TGGGAACAAACTTTCTGTTTAGG + Intergenic
979118750 4:116865479-116865501 TGGGAACAGAATTTCTCTTTGGG - Intergenic
979312093 4:119214830-119214852 AGGGAAAATAATTCTGATTTTGG - Intronic
979841609 4:125449068-125449090 TCGAAAAATACTTACTGTTTCGG + Exonic
979881343 4:125963634-125963656 GGGGAAAATAACTCTTTTTTGGG + Intergenic
980540673 4:134189880-134189902 TGGGAAAATAGTTTCTCTTGAGG + Intergenic
981104338 4:140863624-140863646 TGGGAAAATAATTTATGTATGGG + Exonic
981902065 4:149878351-149878373 TGGCAAAATAATTCCTCGTAGGG + Intergenic
982460485 4:155663715-155663737 TGGGAATATTATTCCAGATTAGG - Intergenic
983286334 4:165743886-165743908 TGGGAAGATTACTCCTGATTGGG - Intergenic
983296104 4:165871418-165871440 TGGGAAAAAAAGTACTGTATAGG - Intergenic
983317162 4:166147089-166147111 TGGGGAAAGAATTGCTGTATTGG + Intergenic
983777513 4:171626640-171626662 TTGGAAAATAAGCCCTTTTTGGG - Intergenic
984183063 4:176508862-176508884 TGGGAACATAAATTCTGTTGGGG + Intergenic
984664801 4:182414269-182414291 TAGCAAAATAAATCCTGGTTTGG - Intronic
985343889 4:188981650-188981672 TGGGAAAAAAAGTCTTTTTTAGG + Intergenic
986447502 5:7835481-7835503 GAGGGAAATAATTCCTGTCTAGG + Exonic
986460367 5:7964107-7964129 TGTGAAAGTAATTGCAGTTTTGG + Intergenic
986515734 5:8561808-8561830 TGGTAAAAAAATTCTTTTTTTGG + Intergenic
987339305 5:16925172-16925194 TGGCCAAATTATTTCTGTTTGGG - Intronic
987755315 5:22093581-22093603 GGGGAAATTAATTGTTGTTTAGG + Intronic
987874709 5:23666414-23666436 TGGGAAAATAAATTATGTTGAGG + Intergenic
987907663 5:24098450-24098472 TAGGAACTTAACTCCTGTTTGGG + Intronic
988214878 5:28258842-28258864 CAGGAAAATGATTCCAGTTTAGG + Intergenic
989815307 5:45729486-45729508 TGGTAAAATAATTTCTCTTAAGG - Intergenic
990396843 5:55390834-55390856 TGGAATAATATTTGCTGTTTTGG + Intronic
991196600 5:63941583-63941605 TGCAAAAATAATTGCAGTTTTGG - Intergenic
994551372 5:101239121-101239143 TGGGATAAGAAAACCTGTTTTGG - Intergenic
994585278 5:101700638-101700660 TGGGAAAACAAGTCTTATTTAGG - Intergenic
995189389 5:109304391-109304413 TGGGAAATTAATTCCTGGCAGGG + Intergenic
996844370 5:127883219-127883241 TGGGATAATGATTCCTGTGGGGG - Intergenic
997027095 5:130077391-130077413 TGAAAAATAAATTCCTGTTTGGG - Intronic
998855921 5:146395102-146395124 TTGGAAAATAATTCCTCTCCTGG + Intergenic
999611343 5:153373188-153373210 TGGGAAAAAAAGTCCTGGATGGG + Intergenic
999852156 5:155553051-155553073 TGAGAAAATGAATGCTGTTTAGG + Intergenic
1000927370 5:167210372-167210394 AGGGAAATTAATTTCTTTTTAGG - Intergenic
1000957655 5:167561621-167561643 TGGGAAATTAATACCTTCTTGGG - Intronic
1001735615 5:173996569-173996591 TAGGAAAATAATTTAAGTTTGGG - Intronic
1001742011 5:174061040-174061062 TGGGGTAATAATTGCTTTTTGGG - Intronic
1001745156 5:174086894-174086916 TGGGAAATGAATTACTGCTTTGG + Intronic
1004307924 6:14517821-14517843 TGGGAACGTAATTCCTGGTGAGG - Intergenic
1004665783 6:17747359-17747381 TGGCAAGATAATTGATGTTTTGG - Intergenic
1004804107 6:19183202-19183224 TCAGAAAATAATGCATGTTTAGG - Intergenic
1006559201 6:34895014-34895036 TGGGAAATTCATATCTGTTTTGG - Intronic
1006664930 6:35686752-35686774 TTGGAAAATAATGCATATTTTGG - Intronic
1007271936 6:40644407-40644429 TGGGAAAGGCATTCCTCTTTGGG - Intergenic
1007454591 6:41966570-41966592 GGAGAACATAATTCCTGGTTCGG - Intronic
1007960773 6:45957042-45957064 TGGGGAAATTCTTCCTGTGTCGG - Intronic
1008203765 6:48626998-48627020 TGGAAAAATGATTCTTCTTTTGG + Intergenic
1008416038 6:51241414-51241436 TGGGAAAATAAGGCTTATTTAGG - Intergenic
1009589687 6:65650923-65650945 TGATAAAATAATCCCTGTTATGG - Intronic
1009600355 6:65789626-65789648 TGAGAAAAATAATCCTGTTTTGG - Intergenic
1010380782 6:75222526-75222548 TAGGAAACTAGTTACTGTTTAGG + Intergenic
1011052248 6:83165432-83165454 TGCAAAAGTAATTGCTGTTTGGG + Intronic
1011092725 6:83624605-83624627 GGGGAAGATAATTCTTGTTGGGG + Intronic
1011574052 6:88774842-88774864 TGGTTAAATGATTTCTGTTTGGG + Intronic
1011954502 6:93009636-93009658 GGGAAAAATATTTTCTGTTTTGG - Intergenic
1012589230 6:100959494-100959516 TGGGTACAGAGTTCCTGTTTGGG - Intergenic
1013187255 6:107770573-107770595 TGGGAAAAGACTGCCTGCTTTGG + Intronic
1013676921 6:112475263-112475285 TGGGAAAATGTTTGCAGTTTGGG - Intergenic
1013843009 6:114420390-114420412 TGGAAAAAGAATGCCTGTTTGGG - Intergenic
1014226920 6:118859799-118859821 TGGTAAAATAGTTCCTTTTGAGG - Intronic
1014686054 6:124501774-124501796 TGGGAAACTAATGCATTTTTAGG - Intronic
1015086317 6:129296703-129296725 TGTAAAAATAATTCTTATTTTGG - Intronic
1016686244 6:146885583-146885605 TGGGAGAACAGCTCCTGTTTGGG - Intergenic
1017154450 6:151310392-151310414 TTTAAAAATCATTCCTGTTTGGG - Intronic
1020315648 7:6903658-6903680 TGTGTAAAGTATTCCTGTTTAGG + Intergenic
1021572646 7:22081849-22081871 TGCAAAAGTAATTGCTGTTTTGG - Intergenic
1021750076 7:23788779-23788801 TAGAAAAATAATTACTGATTTGG - Intronic
1021975784 7:26009920-26009942 TTGGAGGATAATTCCTGTCTTGG + Intergenic
1022420241 7:30213502-30213524 TGGGTACACAGTTCCTGTTTGGG - Intergenic
1022716630 7:32904627-32904649 TGTTAAAATAATTATTGTTTTGG + Intergenic
1022778494 7:33553639-33553661 TCTGTAAATAATTCCTCTTTTGG + Intronic
1023714924 7:43034280-43034302 TGGGTAAAGAATTTCTGTTTGGG + Intergenic
1024156785 7:46634191-46634213 TGTGAGGATTATTCCTGTTTTGG - Intergenic
1024790721 7:52962505-52962527 TTGGAAAATAATTCCAGTGTAGG + Intergenic
1024883915 7:54120115-54120137 TTGGAAAATAATGCTTTTTTAGG - Intergenic
1026995819 7:74615478-74615500 TGGGTAAAGAGTTTCTGTTTGGG + Intergenic
1027047267 7:74999325-74999347 AGGCAAAATAACTCCTGTTCAGG + Intronic
1027301159 7:76837691-76837713 TGGGAAAATCATTCATGCTCTGG + Intergenic
1027756247 7:82215771-82215793 TAAGAAAATAATTCCTGTCAAGG - Intronic
1027780961 7:82519788-82519810 TGGAAAAATAATTCTCTTTTTGG + Intergenic
1028422309 7:90647590-90647612 TGGGCAACTAATTCCTCTTTTGG + Intronic
1029385727 7:100242315-100242337 AGGCAAAATAACTCCTGTTCAGG - Intronic
1029714775 7:102319937-102319959 AGGGAAGAAAACTCCTGTTTGGG - Intronic
1030286907 7:107836425-107836447 TGGGAAAATAGTTCATCTGTTGG - Intergenic
1030694249 7:112567774-112567796 TGGAAAAATAATTTGTTTTTTGG - Intergenic
1030800930 7:113850854-113850876 TATGAAAACAATTCCTGTATGGG - Intergenic
1031385900 7:121150534-121150556 TGGTAGAATAATTTTTGTTTTGG + Intronic
1031655777 7:124352907-124352929 TGGGAAAAAAAAACGTGTTTTGG - Intergenic
1032373917 7:131390028-131390050 TGGGAGAATAATTACTCTTTTGG + Intronic
1032417085 7:131744139-131744161 TGGGAAAAAAATAGCTGTTCAGG + Intergenic
1033728803 7:144152315-144152337 TGGGAGATCAATTCCTTTTTAGG + Intergenic
1037106943 8:15120356-15120378 GGGGAAAATACTACCTGTATAGG - Intronic
1037726535 8:21487143-21487165 AGTGAAAACAATTCATGTTTTGG - Intergenic
1037790590 8:21936739-21936761 TGATAAAAAAATTCCAGTTTGGG - Intronic
1038277382 8:26133225-26133247 TGGGTACAGAATTTCTGTTTGGG + Intergenic
1038486756 8:27940839-27940861 TGGGAAAACCCTCCCTGTTTGGG - Intronic
1038702789 8:29864892-29864914 TGGTAAAATAATTTTTGTTGAGG - Intergenic
1039190670 8:34970649-34970671 AGGGAACATTCTTCCTGTTTTGG + Intergenic
1039592577 8:38762239-38762261 TGGGTACAGAATTTCTGTTTGGG - Intronic
1040753861 8:50745897-50745919 TGGGTACAGAGTTCCTGTTTAGG + Intronic
1041991823 8:64001750-64001772 TGGTAAAATAACTCTTGTTTTGG - Intergenic
1042185190 8:66129802-66129824 TGGCAAAGTAATTGCTGTTTTGG - Intronic
1042239947 8:66653765-66653787 TAGGAAAATAATGCCTGTAAAGG - Intronic
1043117673 8:76279424-76279446 TGTGAAAATAAACCATGTTTGGG + Intergenic
1044615055 8:94131504-94131526 GTGGAAAATAATTGCAGTTTTGG + Intronic
1045016942 8:98008554-98008576 TGAGAAAATATTTCCAGTTTGGG + Intronic
1048753403 8:137704862-137704884 TGAGAAAATAATTCCATTTCTGG - Intergenic
1049997730 9:1047577-1047599 TGGGAAAATAAGTACATTTTGGG - Intergenic
1050689101 9:8205003-8205025 TGCAAAAGTAATTGCTGTTTGGG + Intergenic
1051380283 9:16451132-16451154 GGGGAAAATAATGTGTGTTTAGG + Intronic
1051544382 9:18257988-18258010 TGGGTACAGAATTTCTGTTTGGG + Intergenic
1052629874 9:31023483-31023505 AGGGAAAATAAATCTTGTATAGG - Intergenic
1054996760 9:71400136-71400158 TGTAAAAATAATTCTCGTTTGGG + Intronic
1055673404 9:78630511-78630533 TGAGATAATAATTCCTGCTTTGG - Intergenic
1055778456 9:79792690-79792712 TGGGAAAGTAAATCATTTTTAGG + Intergenic
1058730417 9:107844756-107844778 ATGCAAAATAATTCTTGTTTAGG - Intergenic
1058953553 9:109925484-109925506 GGGGAAAATATTTGGTGTTTGGG + Intronic
1059145930 9:111899209-111899231 TGGCCCAATAATTCCTCTTTCGG - Intronic
1059817058 9:117928522-117928544 TGGCAAAATAATTGCTGATGTGG + Intergenic
1060390053 9:123269246-123269268 TGGGACAATAATTCCAATTTAGG + Intergenic
1060888265 9:127171418-127171440 TTGGAAAATAATCTCTCTTTTGG - Intronic
1061199626 9:129129768-129129790 TATGAAAAAAATTCCTTTTTGGG - Intronic
1185555862 X:1020614-1020636 TGGGAAGAGAGTTTCTGTTTGGG - Intergenic
1186186005 X:7020383-7020405 TGGACAAATAATTGCAGTTTGGG - Intergenic
1188033086 X:25285854-25285876 TGGGAACATGACTCCTGTTATGG - Intergenic
1188163015 X:26825656-26825678 TGGGATATTAATTCTAGTTTTGG - Intergenic
1188372383 X:29385153-29385175 TGGGTAAATAATTTCTATTTTGG - Intronic
1189005200 X:36986900-36986922 TGGGAAAAAAGTTCCTGTATGGG - Intergenic
1189043829 X:37571042-37571064 TGGGAAAAAAGTTCCTGTATGGG + Intronic
1190401645 X:50042131-50042153 TGGGTACAGAATTTCTGTTTGGG + Intronic
1190519107 X:51259223-51259245 TGGGAAAATAAGGCTTATTTAGG - Intergenic
1190857276 X:54308707-54308729 TGGGATAATAATTTATATTTAGG - Intronic
1192084096 X:68078272-68078294 TGGGCCAATAATTCTTGTTGTGG - Intronic
1192212032 X:69133791-69133813 TGGGAGTATAAATTCTGTTTGGG - Intergenic
1192449348 X:71233796-71233818 TGGGAAAATAAAGTGTGTTTGGG - Intergenic
1193022914 X:76811668-76811690 TGGAAAGATATTTCATGTTTAGG + Intergenic
1194322449 X:92466488-92466510 TGGGAAAATGGTTCCTTTTCTGG + Intronic
1194419687 X:93658331-93658353 TGTTAAAATATTTCCTGGTTCGG + Intergenic
1195055160 X:101137446-101137468 TGGGAAAAGAATTGGGGTTTGGG + Intronic
1195539682 X:106048492-106048514 TGGGAAGATAATGTCTGTATAGG + Intergenic
1195714001 X:107800194-107800216 TAGGAAAACAATTGCTCTTTGGG - Intergenic
1197649858 X:129052586-129052608 TAGGGAAATAATTACTGCTTTGG - Intergenic
1197892734 X:131282179-131282201 TGGGAAAATTATTTTTCTTTAGG - Intronic
1199319975 X:146426678-146426700 TGGGACAATCATTCCATTTTTGG - Intergenic
1199467362 X:148154057-148154079 AGGGAAACTGATTCCTTTTTAGG + Intergenic
1200090086 X:153631563-153631585 TGAGAAACTGATTCCTTTTTAGG - Intergenic
1202337242 Y:23825258-23825280 TGGGAAACATTTTCCTGTTTGGG + Intergenic
1202533523 Y:25844813-25844835 TGGGAAACATTTTCCTGTTTGGG - Intergenic
1202604862 Y:26630241-26630263 TGGGTACATAGTTTCTGTTTGGG + Intergenic