ID: 1086592236

View in Genome Browser
Species Human (GRCh38)
Location 11:88529042-88529064
Sequence CTGCTACTTATTTGCAAAAC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 222
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 208}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1086592236_1086592239 15 Left 1086592236 11:88529042-88529064 CCCGTTTTGCAAATAAGTAGCAG 0: 1
1: 0
2: 1
3: 12
4: 208
Right 1086592239 11:88529080-88529102 GCAGTAGAGAATCTAGTGATAGG 0: 1
1: 0
2: 0
3: 5
4: 104
1086592236_1086592238 -7 Left 1086592236 11:88529042-88529064 CCCGTTTTGCAAATAAGTAGCAG 0: 1
1: 0
2: 1
3: 12
4: 208
Right 1086592238 11:88529058-88529080 GTAGCAGAGTTATCAAGTACAGG 0: 1
1: 0
2: 1
3: 10
4: 88

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086592236 Original CRISPR CTGCTACTTATTTGCAAAAC GGG (reversed) Intronic
901851151 1:12016637-12016659 TTGATACTTGTTTGCAAACCAGG - Intergenic
902186690 1:14730797-14730819 CTGCCACTTACTGGCAAATCAGG - Intronic
907656195 1:56343585-56343607 CTGCAACTTATTTGCAACTAAGG + Intergenic
909118544 1:71571373-71571395 CTGCTATTTATTTTTAAAAATGG - Intronic
909719610 1:78753143-78753165 TTCCTATTTATTTGGAAAACAGG + Intergenic
910964123 1:92790490-92790512 CTCCTACTAATGTTCAAAACTGG + Intronic
911406096 1:97441702-97441724 TTTCTACTTATTTACATAACAGG + Intronic
912204392 1:107494153-107494175 TTGCTACTTATTAGCAAAATTGG - Intergenic
912223723 1:107707334-107707356 CTGCTACTGATTTGCAAGTTAGG - Intronic
912502632 1:110132158-110132180 CAGCTACTTAGTGGCAGAACTGG - Intergenic
912914792 1:113803505-113803527 CTGCTTCTCATTGGTAAAACCGG + Intronic
914425854 1:147575167-147575189 CAGGTCCTTATTTGTAAAACAGG - Intronic
915506975 1:156363868-156363890 CTTCTACTTATTTAAAAAAAAGG - Intronic
915908760 1:159899405-159899427 TTGCTAGTTAGTGGCAAAACAGG + Intronic
918461848 1:184784691-184784713 TTGCTACTTATTTGTAAAGGTGG - Intergenic
919378693 1:196826903-196826925 GTGCAAATTATTTGCAACACAGG + Exonic
922001648 1:221484560-221484582 AGGCTGCTTATTTGGAAAACAGG + Intergenic
924848012 1:247792025-247792047 ATGCAAGTTATTTACAAAACTGG - Intergenic
1064570531 10:16688192-16688214 CTGATACTTTTTAGCAATACTGG + Intronic
1065659133 10:27987418-27987440 TTGTTACTTATTGCCAAAACTGG - Exonic
1066758619 10:38734911-38734933 CTGCAACTATTTTGAAAAACAGG - Intergenic
1067900589 10:50236782-50236804 CTGCTACTTATTAGATCAACAGG - Intronic
1069814937 10:71187816-71187838 CAGCTAGTTAGTGGCAAAACTGG + Intergenic
1070276085 10:75008462-75008484 CTGCTATTTATCAGAAAAACAGG + Intronic
1071894699 10:90052992-90053014 CTGAGACTGATTAGCAAAACTGG - Intergenic
1073465071 10:103690107-103690129 CAGCTTCTCATTTGCAAAATGGG + Intronic
1073923621 10:108487612-108487634 CTGTTCCTTGTTTGCAATACAGG - Intergenic
1074483102 10:113845793-113845815 TTGCCAGTTATCTGCAAAACAGG + Exonic
1074665836 10:115722816-115722838 CTGATATTGATTTGCAAGACAGG + Intronic
1075111207 10:119586242-119586264 ATGCTATTTATTTGCTAAAGTGG - Intronic
1076031587 10:127163728-127163750 AAGCTATTTATTTTCAAAACTGG - Intronic
1077020620 11:415696-415718 TTGCTCCTTATTTGGAAAAGGGG - Intronic
1078620164 11:12899869-12899891 CTGCCCCTTATATGCAACACTGG + Intronic
1079144944 11:17842537-17842559 CTGTTTCTTATTAGCAAAAAAGG - Intronic
1085899805 11:80685323-80685345 CTGAAATTTATTTGCAAAATTGG + Intergenic
1086073313 11:82822613-82822635 CAGCTCCTTTTTGGCAAAACTGG - Intergenic
1086592236 11:88529042-88529064 CTGCTACTTATTTGCAAAACGGG - Intronic
1087069636 11:94065118-94065140 AAGCTACTGCTTTGCAAAACAGG - Intronic
1087128521 11:94649539-94649561 CTGATATTTATCTGCAAAGCAGG + Intergenic
1089398236 11:118149648-118149670 CTGGGACTTGTTTGCAAAGCTGG - Intronic
1090016952 11:123094504-123094526 CAGCTCCTTATTTGTAAAATGGG + Intronic
1090038191 11:123266930-123266952 CGGCTACTTATCTACAAAATGGG + Intergenic
1091100445 11:132868096-132868118 CTGCTACTTCTGTGGAAAGCGGG + Intronic
1092599015 12:10038555-10038577 CTACTACTTAATTGGAAAAAGGG + Intronic
1095715275 12:45338779-45338801 TTGCTTCTTATTTCCAAAATGGG + Intronic
1098208535 12:68137748-68137770 CTGTTCCTTATTTGCTAACCTGG + Intergenic
1099351345 12:81573033-81573055 CTGAGACTCATTTGCAACACTGG + Intronic
1105793760 13:23830798-23830820 CTGCTGCTTATTTGTAAAATTGG - Intronic
1107369602 13:39730418-39730440 TAGCTACTTATTTTCAAATCAGG + Intronic
1107521278 13:41184589-41184611 CTGCTAGTTATTCATAAAACTGG - Intergenic
1109230833 13:59755605-59755627 CTGTTACTTGTTGGCAAAAGGGG + Intronic
1109779358 13:67087379-67087401 TTGCGACATATTTGTAAAACTGG - Intronic
1110026410 13:70545788-70545810 ATGCTCATTATTTGCAAAAAAGG + Intergenic
1111625092 13:90774730-90774752 ATGCTAATTATTTTAAAAACCGG + Intergenic
1111931897 13:94521188-94521210 CTGCTACATATCTCTAAAACAGG + Intergenic
1113609164 13:111631202-111631224 CAGATATTTATTTGCCAAACTGG + Intronic
1115739680 14:36375007-36375029 CTGCCACTTATTTGCAGACTTGG + Intergenic
1116435329 14:44889379-44889401 GGGCTACTTATCTGCAAAAATGG - Intergenic
1117929060 14:60820403-60820425 CTGCTACACATTTGCTAAAGTGG - Intronic
1122116094 14:99527980-99528002 TTGCTATTATTTTGCAAAACTGG + Intronic
1124786836 15:32689558-32689580 CTGCTACTCACATGGAAAACAGG + Intronic
1125860800 15:42997794-42997816 CAACTTCTTATTTGCAAATCGGG - Intronic
1126250221 15:46558807-46558829 CTGCTATTTGTTAGCACAACAGG - Intergenic
1129761921 15:78134049-78134071 ATGCTGCTTATTTGCATACCAGG + Intronic
1138215102 16:55197750-55197772 TAGCTTCTTCTTTGCAAAACTGG + Intergenic
1139074135 16:63422822-63422844 CTGCTATTTATTAACAAAGCAGG + Intergenic
1139377655 16:66510363-66510385 CTGCTAATTAGCTGGAAAACTGG - Exonic
1141008904 16:80378614-80378636 CTGCTATTTAATAGCACAACAGG + Intergenic
1142541990 17:666939-666961 CTGCTACTGATTTTGACAACAGG + Intronic
1144264487 17:13555005-13555027 CTGTGAGTTATTTGCAAATCAGG - Intronic
1148183343 17:45622421-45622443 CAGCTACTGATTTGCAAGAGTGG - Intergenic
1148265509 17:46223269-46223291 CAGCTACTGATTTGCAAGAGTGG + Intronic
1153491348 18:5651784-5651806 TTCCTACTTCTTTGCAAATCTGG + Intergenic
1155369142 18:25079540-25079562 CTGCTACTGAATTGTAAAACTGG - Intronic
1155561871 18:27087566-27087588 TTGTTACAAATTTGCAAAACAGG - Intronic
1158195632 18:54882172-54882194 CTGCTATTTATTTCCAAAGTAGG - Intronic
1160161941 18:76479960-76479982 CTGCTATTTGTTTTCAAACCAGG - Intronic
1160261977 18:77302541-77302563 CTGCTACTGATCTACTAAACCGG - Intergenic
1163712573 19:18855442-18855464 CTGCTACTGGTTTAGAAAACTGG + Intronic
925197522 2:1938565-1938587 CTTCTGCTTATTTGAACAACAGG - Intronic
925368278 2:3325653-3325675 CTGCTACGTGTTTGCATAACAGG + Intronic
925873367 2:8290270-8290292 CTGCTATTGATTTTTAAAACTGG - Intergenic
925928401 2:8686152-8686174 CAACTACTAATTTGCAAAAGGGG - Intergenic
926620684 2:15044250-15044272 CTGCTACTTACCTGCAAATCAGG - Intergenic
927102803 2:19800877-19800899 GTGCTCCTCATCTGCAAAACGGG - Intergenic
929118986 2:38468402-38468424 CTGCTACTTTTTTTCATAGCAGG + Intergenic
930503110 2:52247868-52247890 ATGCTATTTATGTGCAAAAATGG + Intergenic
933862856 2:86487497-86487519 CTGGTCCTCATTTGCAAAATGGG - Intronic
936256157 2:110915065-110915087 CTACTATTTAATAGCAAAACAGG - Intronic
936715010 2:115176431-115176453 CAGATCCTCATTTGCAAAACTGG - Intronic
936789404 2:116133287-116133309 CAGAAACTTATTTGGAAAACAGG + Intergenic
940420816 2:153477951-153477973 CTGCTACTTACTTGGAATGCGGG - Exonic
940674146 2:156708332-156708354 CTGATTCTTATTTGCAGACCAGG - Intergenic
941600807 2:167541803-167541825 CTGCTATGTAAATGCAAAACAGG - Intergenic
943335963 2:186614487-186614509 CTGATACATATTTGCCAAATAGG + Intronic
945258453 2:207822263-207822285 CCACTTCTTATTTGGAAAACAGG + Intergenic
945543972 2:211125716-211125738 CTGCTACTAAAGGGCAAAACTGG + Intergenic
945913454 2:215676862-215676884 CTGCTGTCTATTTGCAGAACAGG + Intergenic
946722225 2:222621769-222621791 CTGTTACTCTTGTGCAAAACTGG + Intronic
946726005 2:222662012-222662034 CTGCTACTTATATTCCCAACAGG - Intergenic
947060733 2:226162082-226162104 CAAATACTTATTTTCAAAACAGG + Intergenic
947429513 2:230013926-230013948 CTACTACTTTTTTCCCAAACAGG + Intergenic
1170248670 20:14254641-14254663 CTGCAACTTCTTAGCAACACTGG - Intronic
1170512427 20:17092040-17092062 CTTCCCATTATTTGCAAAACAGG + Intergenic
1170533568 20:17318070-17318092 ATGCTACTTAGTTGCACGACTGG + Intronic
1170608054 20:17888486-17888508 CTGCTACACATTTTCAAAAAGGG + Intergenic
1170693215 20:18633853-18633875 CCGCTGCTTGTTTGCAGAACTGG + Intronic
1171265227 20:23766245-23766267 CTGAGACTTATTTGGAAAAATGG + Intergenic
1172645689 20:36467891-36467913 CTTTTCCTTATCTGCAAAACAGG - Intronic
1177443603 21:21162470-21162492 ATGCTAGTAATTTGCTAAACTGG - Intronic
1177821849 21:26039290-26039312 CTGTTACTTATTGTCAAACCAGG - Intronic
1178187398 21:30238927-30238949 CTGCTAAATATTTGCATAACAGG - Intergenic
1178189617 21:30265313-30265335 CTGCTATTTGATAGCAAAACAGG + Intergenic
1179420232 21:41229747-41229769 CTGCCACTTGAATGCAAAACAGG - Intronic
1183789038 22:40050127-40050149 CTGCTACTTAGTTACGATACTGG + Intronic
1184163802 22:42715549-42715571 CTGCTAATTTTTTGCAAAGAAGG - Intronic
950845722 3:16014268-16014290 ATGCTACTCATCTGTAAAACTGG + Intergenic
950909144 3:16569838-16569860 CTGTAACTTGCTTGCAAAACAGG - Intergenic
951765819 3:26197504-26197526 CTGATACTTACTTGAAAAACTGG + Intergenic
951993658 3:28703450-28703472 CTTCTATTTATTTGCACTACTGG + Intergenic
952034950 3:29188912-29188934 TTGCTATTTATTTGCAAAGTTGG - Intergenic
952072414 3:29654043-29654065 CTTCTACATTTCTGCAAAACAGG + Intronic
953418503 3:42736575-42736597 CTGCGACTTATTTTTAAAACTGG + Intronic
955838249 3:63082332-63082354 CTACTATTTAATTGCACAACAGG - Intergenic
956404356 3:68912416-68912438 CCGCTAATTAAATGCAAAACAGG + Intronic
956447140 3:69336576-69336598 CTGGTACTTATCTGTAAAATGGG + Intronic
957216290 3:77324360-77324382 ATGCTACTTACTGGCAAAATAGG + Intronic
957863858 3:85996445-85996467 ATGCTACCTAGTTGCAAAATTGG + Intronic
959590010 3:108068659-108068681 CTGTTTCTTATCTACAAAACGGG + Intronic
960313284 3:116143389-116143411 CTACTACTTAATAGCACAACAGG + Intronic
960510758 3:118546254-118546276 CTGCTACTAAGTTATAAAACAGG + Intergenic
963938495 3:151078058-151078080 CTGCTTCCTGTTAGCAAAACTGG + Intergenic
964838123 3:160963238-160963260 CAGTTACTTACTTGTAAAACTGG + Intronic
964914355 3:161821736-161821758 CTGCTACCTATCTGAAAAAGAGG - Intergenic
965304562 3:167047673-167047695 ATGTTTCTTATTTGTAAAACAGG + Intergenic
967154350 3:186678898-186678920 CTGCTACTTCTGTAGAAAACTGG + Intergenic
967323729 3:188218547-188218569 ATGCTAATTATTTGAAAACCTGG - Intronic
967462991 3:189768157-189768179 TTGCTGTTTTTTTGCAAAACGGG + Intronic
967484116 3:190010219-190010241 ATTCTTCTTATTTGCAAAATTGG - Intronic
968456034 4:700353-700375 CAGCTTGTTATTTACAAAACTGG - Intergenic
969067957 4:4504873-4504895 CAGCTACTTATTTTCTAAAGTGG - Intronic
969419544 4:7084153-7084175 CTGCTGCTAACGTGCAAAACGGG - Intergenic
971395162 4:26220542-26220564 CGGTTACTTTGTTGCAAAACAGG + Intronic
971881159 4:32375082-32375104 CTGTTATGTATTTGCAAAAATGG + Intergenic
973726939 4:53786452-53786474 GTTTTACTTATTTGCAAAATGGG - Intronic
977866424 4:102033800-102033822 TTGCTACTTATTTGGGATACAGG - Intronic
978403671 4:108357591-108357613 TCGCTACTTACTAGCAAAACTGG + Intergenic
979002108 4:115234910-115234932 CTGGTATTTATTTGCACAGCAGG + Intergenic
982536861 4:156617712-156617734 CACCTCCTTATTTGCAAGACTGG + Intergenic
988300173 5:29414128-29414150 CTGCTATTTGATTGCACAACAGG - Intergenic
989641432 5:43586933-43586955 TTGCTGCTTCTTAGCAAAACTGG + Intergenic
990221380 5:53593262-53593284 GGGCTAATTATTTGAAAAACAGG - Intronic
990764669 5:59168891-59168913 CTGCTTCATAGATGCAAAACTGG - Intronic
991356030 5:65769326-65769348 CTGCTACTTGATAGCACAACAGG + Intronic
992062872 5:73073938-73073960 CTGCTACTGATTTTCCAAAGTGG - Intronic
992134958 5:73735368-73735390 CTGCTACTAAATTGTAAAACAGG - Intronic
992185424 5:74239665-74239687 CTGCCACTTATTAGCTAAAAAGG - Intergenic
993219624 5:85074947-85074969 CTGCTTATTATTTGCAACCCTGG - Intergenic
994206799 5:97044539-97044561 CTGCCAATTACTTGCAGAACTGG - Intergenic
995277771 5:110296569-110296591 CAGCTACTAAGTTGCAGAACTGG - Intronic
999330250 5:150669039-150669061 CTGCTAATTGTCTCCAAAACTGG - Intronic
999366477 5:151026958-151026980 CTGCAACCAATTTGGAAAACAGG + Exonic
999478115 5:151920472-151920494 CTTCTGCATATTTGCCAAACTGG - Intronic
1000653599 5:163848751-163848773 ATGTTACTTAGCTGCAAAACTGG - Intergenic
1001225048 5:169936974-169936996 CTGCCACTGCTTTGCAAAAATGG + Intronic
1001310297 5:170605351-170605373 CTGCAATTTCTTTGCAAGACAGG + Intronic
1002773677 6:310365-310387 CTTCTACTAATCTACAAAACAGG - Intronic
1004100986 6:12611156-12611178 CTCCTACCTATTTACAAAAGAGG + Intergenic
1004546433 6:16602914-16602936 CGGCTACTCATTTACAAAACAGG + Intronic
1005137925 6:22592587-22592609 CTGTTACCTATTTCCCAAACAGG - Intergenic
1006198883 6:32268336-32268358 CTCCTACTTATTTGCGATTCAGG - Intergenic
1006740909 6:36308069-36308091 ATGCTACTTAAATACAAAACTGG + Intronic
1006869457 6:37237658-37237680 CTGCTACATATTTGCACAATGGG + Intronic
1008560348 6:52718465-52718487 CCTCTACCTATTTGCAAAAAAGG + Intergenic
1010496379 6:76537772-76537794 CTGCGACTTAGTTGTAAAGCAGG - Intergenic
1011221918 6:85063846-85063868 CAGCTAATTATTAGCAAACCTGG - Intergenic
1013516682 6:110893579-110893601 TTGCTGCTTCTTAGCAAAACTGG - Exonic
1013754960 6:113450830-113450852 CTGCTACTTATATTCCTAACTGG + Intergenic
1014373735 6:120645049-120645071 CTGTTAATTATTTGCATAATTGG - Intergenic
1014524656 6:122488339-122488361 TTGCTACGTATTTGGCAAACGGG + Intronic
1015234952 6:130960094-130960116 CTGTTTATTATTTGTAAAACAGG - Intronic
1015803803 6:137088695-137088717 GTGCTATGTATTTGCAAAATTGG + Intergenic
1016189424 6:141244718-141244740 CAGCTATTTATTTATAAAACAGG + Intergenic
1016535092 6:145101123-145101145 CTGCTAAATATTTGAAAAAGTGG + Intergenic
1020152394 7:5693057-5693079 CAGCTCCATATTTGCACAACGGG + Intronic
1020911274 7:14134865-14134887 CTCCAATTTATTTGCAAAATTGG - Intergenic
1021255774 7:18390687-18390709 CAGCTAGTTAGTGGCAAAACTGG - Intronic
1022041138 7:26582457-26582479 CTGCTGCTTAATTCCAAAGCTGG - Intergenic
1022621148 7:31985928-31985950 TTGCTCCTCATTTGCATAACAGG + Intronic
1031461663 7:122058196-122058218 CTGCTACTTGTTTTTAAAAAAGG + Intronic
1035882677 8:3259068-3259090 CTGCTACTTATATATAAAGCAGG + Intronic
1036498836 8:9295122-9295144 TGGCCACTTATTTACAAAACAGG + Intergenic
1038646868 8:29369279-29369301 CTGCAACTTATCTGCAGACCTGG - Intergenic
1039759817 8:40562456-40562478 CTGCTACTTATTTTAAAAGAGGG + Intronic
1041631637 8:60094932-60094954 CTGCTACTTGTCTGCAAACTTGG - Intergenic
1043125418 8:76388468-76388490 ATGCTACTTATTCAAAAAACAGG + Intergenic
1045116142 8:98982478-98982500 ATGTTACTCATTTGTAAAACAGG - Intergenic
1045581369 8:103484029-103484051 ATGTTCCTCATTTGCAAAACAGG - Intergenic
1046240913 8:111490941-111490963 CTGTAACCTATTTGAAAAACAGG - Intergenic
1046389743 8:113554713-113554735 ATGCTACTGCTTTGCAAATCAGG + Intergenic
1048983877 8:139719905-139719927 CTGCTGCTTATTTCAAAAAGAGG - Intergenic
1050395427 9:5189921-5189943 CTGTTACCTTTTGGCAAAACTGG - Intergenic
1051940313 9:22497302-22497324 TTAATACTAATTTGCAAAACAGG + Intergenic
1052402139 9:28013690-28013712 CTGCTTCTTATTAGCAAGCCAGG - Intronic
1053437226 9:38084050-38084072 GTGCTACCTTATTGCAAAACTGG - Intergenic
1053474841 9:38375363-38375385 CAGCTGTTTATTTGCAAAGCCGG - Intergenic
1054780159 9:69158591-69158613 CTTCTTCTTATTTTCAAGACAGG + Intronic
1056250615 9:84744439-84744461 GTGCAACTTATTTGCACAAAGGG - Intronic
1060254703 9:122017014-122017036 CTGCTCTTCATTTGCAAAACCGG - Intronic
1060712640 9:125884456-125884478 CTGCTTCATAATTGCAAACCTGG - Intronic
1187921582 X:24207913-24207935 ATGCTACTTATTTCAAACACTGG - Intronic
1188435922 X:30158395-30158417 CAGCTACTTATTTTTAAGACAGG - Intergenic
1188971307 X:36618891-36618913 CTGCTGCTTCTTTGCAAAACTGG - Intergenic
1188971839 X:36627370-36627392 CTACTACTTGATGGCAAAACAGG - Intergenic
1190775350 X:53548123-53548145 CTGGGACTTATTGGTAAAACTGG - Exonic
1193843251 X:86435823-86435845 CTGCCATTTATTTGTAAAAAGGG - Intronic
1194237159 X:91398993-91399015 ACGCTACTTATTTTCACAACTGG + Intergenic
1195279340 X:103315160-103315182 GTACTACTGATTTGGAAAACTGG + Intergenic
1197079951 X:122400337-122400359 CTGCTACTCATTTGGAGTACGGG + Intergenic
1198710571 X:139497311-139497333 CTTCTACTTATTTCCCAAGCTGG + Intergenic
1200703153 Y:6419320-6419342 CTGCTACTTAGCTGAGAAACAGG - Intergenic
1201030957 Y:9745387-9745409 CTGCTACTTAGCTGAGAAACAGG + Intergenic