ID: 1086593519

View in Genome Browser
Species Human (GRCh38)
Location 11:88543837-88543859
Sequence GCAACCATGTTATCTGCTAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 93
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 85}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086593519 Original CRISPR GCAACCATGTTATCTGCTAT GGG (reversed) Intronic
912689178 1:111791388-111791410 GCAGCCATGCTGTCTGCCATGGG + Intronic
913943139 1:125127133-125127155 ACAACCATGTCATCTGCAAACGG - Intergenic
915929799 1:160053248-160053270 CCAACCATATTATCTGTTTTTGG + Intronic
918632366 1:186732813-186732835 ACACCAATATTATCTGCTATTGG - Intergenic
919329406 1:196150835-196150857 ACAAACATAATATCTGCTATCGG + Intergenic
919836767 1:201580160-201580182 GCCACCATCTAATCTGCTAAGGG - Intergenic
921899669 1:220436929-220436951 ACAACCATGTTACCTGGGATGGG - Intergenic
1064590738 10:16888171-16888193 TCAACCTTGTTATTCGCTATTGG - Intronic
1067686867 10:48470998-48471020 GCAACCTTGTTAGCTGGTAGTGG - Intronic
1071425605 10:85546115-85546137 GCAACCACGTCCTCTGCTAGGGG + Intergenic
1079118515 11:17657207-17657229 GCAACCTTGTTTACTGCTGTTGG + Intergenic
1083469195 11:62871200-62871222 GCAGGCATGTTATTTGCTAAAGG - Intronic
1086593519 11:88543837-88543859 GCAACCATGTTATCTGCTATGGG - Intronic
1088065649 11:105715824-105715846 GCATCCATGTCATCTGCCTTCGG + Intronic
1093592765 12:20924960-20924982 TCAACCATGTTACTTGCTATTGG + Intergenic
1093606769 12:21100747-21100769 TCAACCATGTTACTTGCTTTTGG + Intronic
1094287479 12:28811637-28811659 CCAACCAGGTTATCTGTCATAGG + Intergenic
1096211097 12:49766550-49766572 GCCCCCATTTTATCTGCTAGGGG + Intergenic
1097845690 12:64363270-64363292 ACAACCATGTTACCTGCTGAAGG + Intronic
1101273597 12:103175078-103175100 GCAAGGATATTATATGCTATAGG + Intergenic
1105708731 13:22984770-22984792 ACTACCATGTTACCAGCTATCGG + Intergenic
1111922992 13:94432088-94432110 GCAGCCATCTTACCTGCTAGAGG - Intergenic
1113602018 13:111576403-111576425 GTAACCAAATTATCTGCAATAGG + Intergenic
1119930193 14:78538540-78538562 GCAATCATGTCATCTGCAAATGG + Intronic
1124113513 15:26816634-26816656 GTAACCACGTTAGCTACTATTGG - Intronic
1129014192 15:72451298-72451320 GCAACCATGATATCTGCTGAGGG + Intergenic
1131591489 15:93754108-93754130 ACAATCATGTTATCTGCAAATGG + Intergenic
1131711816 15:95063889-95063911 AAAACCATGTGATCTGCTTTTGG + Intergenic
1135143566 16:19942050-19942072 GCCACCATGTTTTCTACCATGGG - Intergenic
1136770763 16:32838611-32838633 ACAACCATGTCATCTGCAAACGG + Intergenic
1137083377 16:36093848-36093870 ACAACCATGTCATCTGCAAACGG + Intergenic
1137609544 16:49809645-49809667 GCCAGCATGTGGTCTGCTATGGG - Intronic
1141449790 16:84090896-84090918 GTAATCATGGTTTCTGCTATTGG - Exonic
1203073185 16_KI270728v1_random:1100720-1100742 ACAACCATGTCATCTGCAAACGG + Intergenic
1145691066 17:26739906-26739928 ACAACCATGTCATCTGCAAACGG - Intergenic
1146899792 17:36575963-36575985 GAAACATTGTTATCTACTATTGG + Intronic
1150530609 17:65977576-65977598 CCCACCATGTTCTCTGCCATAGG - Intronic
1156202890 18:34854525-34854547 ACAATCATTTTATCTGCTGTTGG + Intronic
1157966495 18:52214411-52214433 GCAATCTTGTTCTCTGCTTTTGG - Intergenic
1162065695 19:8123976-8123998 GGAACCATGTTTCCTGCGATGGG - Exonic
1164493175 19:28732914-28732936 GCAACCATGTAGGCTGCTTTGGG + Intergenic
1164667266 19:30049638-30049660 GCAACTCTTTTATGTGCTATCGG - Intergenic
1166192369 19:41183483-41183505 GCAGCAATGTTCTCTGCTCTGGG - Intergenic
1167521153 19:49956014-49956036 GCAAACAGGTTTTCTGCTAAAGG - Intronic
931306970 2:61038820-61038842 ACAACCATGTCATCTGCAAACGG - Intronic
931490993 2:62747299-62747321 GCAAAAATGTCATCTGCTTTAGG - Intronic
1171199257 20:23227879-23227901 GCACCCATATTGTCTGCTAAGGG - Intergenic
1175402269 20:58707414-58707436 GCAGCCATGTTCTCTGCTCAGGG + Intronic
1180856072 22:19046441-19046463 GCAATCATGTGATCTGCAAAGGG + Intronic
1203324197 22_KI270737v1_random:101803-101825 ACAACCATGTCATCTGCAAACGG + Intergenic
954790953 3:53133067-53133089 GCATCCATGTAAGCTGCTTTGGG + Intergenic
955011686 3:55022938-55022960 GTAAACATGTTATTTACTATAGG - Intronic
955420408 3:58730864-58730886 ACAACCATTTTCTCTGCTAGGGG + Intronic
958924505 3:100143198-100143220 ACAATCATGTTATCTGCAAATGG + Intronic
959863478 3:111241576-111241598 ACAACCATGTCATCTGCAACAGG + Intronic
962893679 3:139695154-139695176 GCAACCAGGTTTTCTGCTGGAGG + Intergenic
964147082 3:153476978-153477000 TCAATCATGTTACCTGCTGTTGG + Intergenic
965110238 3:164411680-164411702 ACAATCATGTTATCTGCAAACGG + Intergenic
965295250 3:166937169-166937191 ACAATCATGTTATCTGCAAACGG + Intergenic
974997230 4:69176295-69176317 GCAATCATGTCATCTGCAAAAGG - Intronic
975389732 4:73802347-73802369 GCAACAATGGTATAAGCTATAGG - Intergenic
979290122 4:118970611-118970633 GAAATGAGGTTATCTGCTATGGG - Intronic
982243439 4:153323899-153323921 GGATCCATGTTATCTGCAACTGG + Intronic
986936809 5:12898864-12898886 GCCATCATATTATCTTCTATAGG + Intergenic
994577282 5:101594787-101594809 GCAGCCATGTTTTCTTCTCTAGG - Intergenic
995006281 5:107199938-107199960 GCAAACATTTCATCTGCTTTTGG - Intergenic
995820802 5:116229557-116229579 GCAACACTGTTAGCTGCTAAAGG + Intronic
997575960 5:134977423-134977445 GCAACCAAGTTCTTTGCTAAGGG + Intronic
1009589825 6:65653208-65653230 GCAACCCTGTCATCTGCTTCTGG - Intronic
1014236287 6:118959098-118959120 CCAACAATGTTAAATGCTATGGG - Intergenic
1015353351 6:132248420-132248442 GCATCCGTATTATCTGCTAAGGG - Intergenic
1017567304 6:155701415-155701437 GCAGCACTGTTATCTGCTTTGGG - Intergenic
1022664426 7:32397667-32397689 TCAACCATGTTCTCTCCTATAGG - Intergenic
1023644864 7:42300132-42300154 GTAACCATTTTATTTGCTCTAGG - Intergenic
1024126275 7:46299434-46299456 ACAACCAAGTTGTCTGCAATAGG - Intergenic
1024578587 7:50783677-50783699 CCTACCATGTTCTCTGCTAGAGG - Intronic
1025479531 7:60964669-60964691 ACAACCATGTCATCTGCAAATGG - Intergenic
1025552451 7:62267656-62267678 ACAACCATGTCATCTGCAAACGG + Intergenic
1028900945 7:96100059-96100081 TCAACCATGTTCTCTGCAATAGG - Intronic
1031259585 7:119501299-119501321 GAAACCATGTCACCTGCTGTGGG + Intergenic
1031594782 7:123637485-123637507 GCAACAATGTTAGATGCTGTAGG - Exonic
1032340160 7:131064217-131064239 CAAACCATGTTATCTGATAAGGG + Intergenic
1037042154 8:14249465-14249487 GCAACCATATTATTTACTAAAGG + Intronic
1039724149 8:40197229-40197251 GCAACCATATTAACTGCAATTGG + Intergenic
1045612059 8:103856179-103856201 GCAACTCTGTTATCTGATATAGG + Intronic
1051932804 9:22406735-22406757 GCAGCCATGTTAATTGCTAGAGG - Intergenic
1057278598 9:93693395-93693417 ACAATCATGTCATCTGCAATGGG - Intergenic
1060167810 9:121433920-121433942 GCCACCATGGTCTCTGCTGTTGG - Intergenic
1190970098 X:55340382-55340404 GCAGCCATGTTAACTGCAACAGG + Intergenic
1195292866 X:103445953-103445975 GAAACTATTTTATCTGCTATAGG + Intergenic
1195403595 X:104488631-104488653 TGAAGCATGTTATCTGCTAATGG + Intergenic
1195657427 X:107345438-107345460 GCACCAATAATATCTGCTATAGG + Intergenic
1199479880 X:148286532-148286554 GAAACAATGTGACCTGCTATTGG + Intergenic