ID: 1086596091

View in Genome Browser
Species Human (GRCh38)
Location 11:88572757-88572779
Sequence ATAAAAAATACAACCATTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 699
Summary {0: 1, 1: 0, 2: 2, 3: 50, 4: 646}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1086596091_1086596097 28 Left 1086596091 11:88572757-88572779 CCATCAATGGTTGTATTTTTTAT 0: 1
1: 0
2: 2
3: 50
4: 646
Right 1086596097 11:88572808-88572830 GTTACTGGAAGTGTATGTAGAGG 0: 1
1: 1
2: 2
3: 20
4: 130
1086596091_1086596096 13 Left 1086596091 11:88572757-88572779 CCATCAATGGTTGTATTTTTTAT 0: 1
1: 0
2: 2
3: 50
4: 646
Right 1086596096 11:88572793-88572815 TTACTGTAATGGTAAGTTACTGG 0: 1
1: 0
2: 0
3: 13
4: 140
1086596091_1086596094 2 Left 1086596091 11:88572757-88572779 CCATCAATGGTTGTATTTTTTAT 0: 1
1: 0
2: 2
3: 50
4: 646
Right 1086596094 11:88572782-88572804 CTGTTTCATCCTTACTGTAATGG 0: 1
1: 0
2: 0
3: 19
4: 156

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086596091 Original CRISPR ATAAAAAATACAACCATTGA TGG (reversed) Intronic
900821527 1:4893181-4893203 ACAAAAAATACAAAAATTGGTGG + Intergenic
900906099 1:5559560-5559582 ATAATATATATAACCATTCATGG + Intergenic
902278849 1:15359688-15359710 AAAAAAAATACAAAAATTAATGG + Intronic
902578164 1:17391659-17391681 ATAAAAATGACAACCATGCATGG + Intronic
902894553 1:19470055-19470077 ACAAAAAATACAAAAATTGCTGG + Intronic
903432891 1:23321727-23321749 CTAAAAAATTCAACAATTTAAGG + Intronic
903878905 1:26495335-26495357 ACAAAAAATACAAAAATTGCCGG + Intergenic
904124298 1:28225862-28225884 AAAAATAATACAAACATTGCTGG - Intronic
904197431 1:28796228-28796250 ATAACAAATTCTACCATTGCAGG - Intergenic
904220407 1:28963213-28963235 AAAATAAATAGAAGCATTGATGG - Intronic
906502280 1:46350109-46350131 ATAAATAATACAAGAATTGGAGG + Intronic
907230183 1:52990494-52990516 ATAAAAAAGACAACCAGGCACGG + Intronic
908488619 1:64620158-64620180 TTAAAAAATTAAAACATTGAAGG - Intronic
909060465 1:70873365-70873387 CTAAGAAATACAACCATTTCTGG - Intronic
909484126 1:76155009-76155031 ATAAAAAATAAAAAGATTGGTGG - Intronic
909592357 1:77365023-77365045 ATAAAAAAAACAACAAATGTTGG - Intronic
909633398 1:77790083-77790105 ATATAAAATGTAACCATTGGGGG - Intronic
909662078 1:78095287-78095309 ATAAGAAAGACAACTATTGAAGG + Intronic
909841122 1:80325900-80325922 ATAAAAAATACAAAAATTAGCGG + Intergenic
909940166 1:81602295-81602317 ATTAAAAATACAACTATTGGTGG + Intronic
910064157 1:83132962-83132984 TTGAAACATATAACCATTGAGGG - Intergenic
910131928 1:83917708-83917730 ATTAAAATTACAACCACTAATGG + Intronic
910281357 1:85504949-85504971 AAAAAAAAAAGAATCATTGAGGG - Intronic
910738864 1:90493906-90493928 AAAAAAAATACAAGAAGTGAAGG - Intergenic
910739741 1:90501959-90501981 AAAAAAAATTCAACCGTAGAGGG + Intergenic
910843181 1:91580827-91580849 TTTAAAAATACAACCACTGTAGG + Intergenic
910898877 1:92097722-92097744 ATAAAATATACAGCCATAAAGGG - Intronic
910920484 1:92341169-92341191 ACAAAAAATACAAAAATTGGCGG - Intronic
911352782 1:96774448-96774470 ATAAAATAAACAAACACTGAAGG - Intronic
911581235 1:99635673-99635695 ATAAAAATCACAACCTTTTAGGG - Intergenic
911704128 1:100991294-100991316 CTAAACAATACAACCATTAAAGG - Intronic
912991404 1:114490373-114490395 ATAAAAAAGATAACAATTGTTGG + Intronic
913300547 1:117365739-117365761 ATAAAAAGTAAAAATATTGAGGG - Intergenic
913426854 1:118741211-118741233 ATATATAATGCAACCATTGTAGG - Intergenic
914458667 1:147861605-147861627 ATAGAAAATACAAAGAATGATGG + Intergenic
915190095 1:154142725-154142747 ATTAAAAATACAAACATTAACGG + Intronic
915835028 1:159169917-159169939 ATATAAATTACAAGCAATGATGG - Intergenic
916837114 1:168557250-168557272 ATAAAAAATATAGCCTTTTACGG + Intergenic
917055374 1:170976149-170976171 ATAAATAACACAAACCTTGAAGG - Intronic
917360341 1:174168327-174168349 ATTGAAAAATCAACCATTGAAGG + Intronic
917863576 1:179171877-179171899 AAAAAGAATAAAATCATTGATGG + Intronic
917997655 1:180457603-180457625 AGAAAAATTACAACCATTTAAGG + Intronic
918032554 1:180829733-180829755 TTATATAATACAACCAATGAAGG - Intronic
918265423 1:182837970-182837992 ATTAAGAATAAAATCATTGAAGG - Intergenic
918667352 1:187168037-187168059 AAAATAAATACAACACTTGATGG + Intergenic
918813740 1:189155775-189155797 GTAAAGAATACAACAATAGATGG + Intergenic
919216185 1:194558678-194558700 ATAACAGATTCAACAATTGAAGG - Intergenic
919281104 1:195490115-195490137 ATAAAAATTACATACATTTATGG - Intergenic
919345096 1:196365702-196365724 ATATAAAATACAAACATGCAAGG + Intronic
919468508 1:197950564-197950586 ATAAAATCTACTACCTTTGAGGG - Intergenic
919527833 1:198677048-198677070 TTGAAAATTACTACCATTGATGG + Intronic
920768387 1:208855628-208855650 TTAAAACACACAACCATTCATGG + Intergenic
921040396 1:211425671-211425693 ACTAAAAATACAAAAATTGACGG + Intergenic
921858034 1:220009932-220009954 ACTAAAAATACAAACATTGCTGG + Intronic
922392973 1:225166206-225166228 CTCAAAAGTAAAACCATTGATGG - Intronic
922528159 1:226322262-226322284 ATAAAATATACAAAAATTGCTGG - Intergenic
922663907 1:227452940-227452962 ACAAAAAATACAAAAATTAACGG - Intergenic
923402319 1:233627244-233627266 ATAAAAAATACAGTATTTGAGGG - Intronic
923456812 1:234171901-234171923 ATAAAAATTACATACATTTATGG - Intronic
924551416 1:245081455-245081477 ATAAAAAATAAAAAAATTGCCGG - Intronic
1062791768 10:311230-311252 ATGCAAAATACAGCCATGGAGGG + Intronic
1062814182 10:487555-487577 AAAAAAAAAACACTCATTGATGG - Intronic
1064246559 10:13672386-13672408 ATAAGTAACACAACTATTGAGGG + Intronic
1064728363 10:18303937-18303959 ATAAAAAATAAAAACACTGGCGG - Intronic
1064913432 10:20428471-20428493 ATAAAAAATAAAAATATAGAAGG + Intergenic
1065073141 10:22048573-22048595 ACAAAAAATACAAACCATGAAGG + Intergenic
1065344529 10:24736142-24736164 ATAAAAAATAAAACAATAGGTGG - Intergenic
1067013255 10:42734392-42734414 GCAAAAAATACAAACATTGGTGG + Intergenic
1067270420 10:44787017-44787039 ATAAAAAATAATATCATGGAGGG - Intergenic
1068294901 10:55057245-55057267 AAAAAAATTACAACCACTAAAGG - Intronic
1068450264 10:57177551-57177573 ATAAAAAATAAAAAAATTAAAGG + Intergenic
1068465190 10:57380944-57380966 AAAAAAAAAAAAACCCTTGAAGG + Intergenic
1069027588 10:63560495-63560517 ATGAAAAATAAAACCACTTATGG - Intronic
1069371866 10:67756343-67756365 ATAAAAAAGACAAATATTTAAGG + Intergenic
1071073276 10:81720387-81720409 GTAAAAGATACAAAGATTGAAGG + Intergenic
1072430111 10:95363660-95363682 ATAAAAAATATATATATTGAAGG + Intronic
1073175511 10:101554091-101554113 AGAAAAGATGCAGCCATTGATGG - Exonic
1073394717 10:103208320-103208342 ATAAAAAATAAAAAAATTAAGGG - Intergenic
1074118459 10:110475638-110475660 ACAAAAAATACAAAAATTGCTGG - Intergenic
1074240121 10:111630328-111630350 ATAAAACATAAAACTAGTGAAGG + Intergenic
1074311229 10:112324975-112324997 ATTAAAAATACAAAAATTGCTGG + Intergenic
1074326050 10:112452268-112452290 ATAAAAAATTTAAGCATTTAGGG + Intronic
1075294009 10:121257066-121257088 ATAAAAAGCACTACCATAGAAGG + Intergenic
1076659565 10:132046462-132046484 AAAAAAAAAACAACCATCCAGGG + Intergenic
1077179586 11:1206353-1206375 ATAAAAAATAAAACCCCAGAGGG + Intergenic
1077978566 11:7275518-7275540 ATAAAAAATGCCAACATTTAAGG - Intronic
1078833641 11:15002930-15002952 AAAAAAAAAACAACCCTTGATGG - Intronic
1080219868 11:29889214-29889236 GTAAAAATTACAACAGTTGAAGG + Intergenic
1080544839 11:33306353-33306375 AGAAAAAATAAATTCATTGAGGG + Intronic
1080549225 11:33356126-33356148 ACAAAAAATACAACATTTCAGGG - Exonic
1081394647 11:42571770-42571792 ATAAAAATTCCAATAATTGATGG + Intergenic
1081440613 11:43076859-43076881 ACAAAAAAGAAATCCATTGAGGG - Intergenic
1081643718 11:44775779-44775801 ATGAAAAATAAATTCATTGATGG - Intronic
1081770191 11:45645634-45645656 ATAAAAACTAAATCCCTTGAAGG + Intergenic
1081833274 11:46132793-46132815 ATAAAAAATAAAAACTTTAATGG - Intergenic
1081848331 11:46257375-46257397 ACAAAAAATACAAAAATTAATGG - Intergenic
1082875562 11:57984925-57984947 ATAAAATATACAAGCCATGAAGG + Intergenic
1083238218 11:61366011-61366033 AAAAAAAGTACAACCAATGAAGG - Intronic
1083767011 11:64846334-64846356 ATAAAAAATACAAACATGGCTGG - Intergenic
1085747940 11:79130479-79130501 AAAAAAAATACAAGAAGTGAAGG + Intronic
1085899269 11:80678529-80678551 ATAAAATATAAAATCATTGCAGG + Intergenic
1086443619 11:86851892-86851914 ATGAAAAGGACAACCATTGGTGG + Intronic
1086596091 11:88572757-88572779 ATAAAAAATACAACCATTGATGG - Intronic
1086640184 11:89144565-89144587 ATAAAAATTACATGCATTCACGG - Intergenic
1087352926 11:97056118-97056140 ATAAAAAATACTTCAATTGGAGG - Intergenic
1087466487 11:98513553-98513575 ATGGAAAATACAGACATTGATGG - Intergenic
1088177253 11:107067520-107067542 ATGAAGAAAACAACCATTCATGG - Intergenic
1088939862 11:114442344-114442366 AAAAAAAATACTAACAATGATGG - Intronic
1089410001 11:118233014-118233036 ATAAGAAATACCACCCTGGAAGG - Intronic
1090174695 11:124638169-124638191 ACAAAAAATACACCCAAGGATGG + Intronic
1090222537 11:125041770-125041792 TTAAAAAATACAACACTTAAAGG - Intergenic
1090495520 11:127207686-127207708 TTAAAAAATAAAAACATTAAAGG + Intergenic
1091382017 12:67772-67794 GTAGAAAAGAGAACCATTGAAGG + Intronic
1091454794 12:598998-599020 AACAAAAATACAAGCATTGTAGG - Intronic
1092094677 12:5831820-5831842 AGAAAATAAACAACCATCGAGGG - Intronic
1092186589 12:6484326-6484348 ATAAAAATTACATATATTGATGG - Intergenic
1092213721 12:6665724-6665746 ACTAAAAATACAAAAATTGATGG - Intergenic
1092460770 12:8684043-8684065 ATCAAAATTACAAACATTGGTGG - Intronic
1092802707 12:12186539-12186561 CTAAAAAATACAAAAATTAATGG - Intronic
1092887318 12:12936379-12936401 ATAAAACATAAAACTATTTATGG - Intergenic
1092895850 12:13009650-13009672 ACAAAAAAGACAACCAGTGTTGG - Intergenic
1093290163 12:17309822-17309844 TTAAAACAAACAAACATTGAAGG - Intergenic
1093424043 12:19008155-19008177 ATGAAAAATAAAACCATAGTGGG + Intergenic
1093699842 12:22206970-22206992 TTAAAAAATATAACAAATGATGG + Intronic
1094142389 12:27194583-27194605 ATATAAAATATAACCATTGGGGG + Intergenic
1094149996 12:27272170-27272192 ATAAATAATACAACGAATTAAGG + Intronic
1094433969 12:30400403-30400425 GTAAAAAATACACCCATGGGTGG - Intergenic
1094611420 12:31998991-31999013 ACTAAAAATACAAACATTGGTGG + Intergenic
1095209748 12:39478602-39478624 ATATAAAATTCAACATTTGACGG + Intergenic
1095256125 12:40038567-40038589 AAAAAAAATACAAAAATTAATGG + Intronic
1095900754 12:47325610-47325632 ATTAAAAATACAAAAATTGGCGG - Intergenic
1096827209 12:54288910-54288932 AAAAAAAATACAAACATTAGCGG + Intergenic
1097065663 12:56318680-56318702 ATAAAAAATAAAAGCATGGGGGG - Intronic
1097401319 12:59131465-59131487 AAACACAATACAACCAATGAAGG + Intergenic
1097482260 12:60143455-60143477 ATAAAAATTAAAACCAATGGAGG - Intergenic
1097957322 12:65499492-65499514 GTGATAAATACAACCACTGATGG - Intergenic
1098010455 12:66045295-66045317 AAAATAAATACAATCAGTGAGGG + Intergenic
1098141727 12:67456897-67456919 AGAAAAAAAAAAAGCATTGAAGG + Intergenic
1098561674 12:71880026-71880048 AGAAATTATACAACCATTGATGG + Intronic
1098935615 12:76475477-76475499 TTAAAAAATAGAACTATTAAGGG - Intronic
1099287760 12:80736223-80736245 ATAGAAAATACAACCTTTTTTGG - Intergenic
1099447212 12:82766566-82766588 CTAAAAAATGCAACTATGGAAGG - Intronic
1099568988 12:84290300-84290322 ATATAAAATACTTCCATTCAAGG - Intergenic
1099623786 12:85040185-85040207 AAAATATATACAACTATTGAGGG + Intronic
1100509686 12:95257178-95257200 AAAAAAAATCCAACTTTTGATGG - Exonic
1100725938 12:97408789-97408811 AAAAAAAAAAGAACCATTTAGGG - Intergenic
1101632796 12:106511832-106511854 ATAAAAGATACAACCATTCAAGG - Intronic
1101761391 12:107661643-107661665 CTAAAAAATACAAAAATTAACGG + Intergenic
1102111596 12:110369433-110369455 AAAAAAAATTAAACCATGGAAGG - Intergenic
1102850235 12:116236224-116236246 ATAAATAAGAGAACCATTGTGGG - Intronic
1103104554 12:118211794-118211816 ATAAAAATTACTACCATAAAAGG - Intronic
1103352679 12:120295922-120295944 ATACAAAATACAAAAATTAACGG + Intergenic
1103417506 12:120753292-120753314 AAAAAAAAAACCACCATTGCTGG - Intergenic
1105565705 13:21545517-21545539 CTAAAAAATACAAAAATTGATGG + Intronic
1105763963 13:23540065-23540087 ACAAAAAATACAAAAATTGACGG + Intergenic
1106368790 13:29111090-29111112 ATAAAAAATGGAACCACTTATGG + Intronic
1106419828 13:29576989-29577011 TAAAAAAAGACAACCAGTGATGG - Intronic
1107799441 13:44090517-44090539 ATCAGAAAACCAACCATTGAGGG - Intergenic
1107876025 13:44790717-44790739 ATAAAAAATAGAAGAATTAAAGG - Intergenic
1108329422 13:49370402-49370424 GTGAAAAATACGACCACTGATGG + Intronic
1109111559 13:58327130-58327152 ATAAAAAATAGAGTCAGTGATGG + Intergenic
1109715137 13:66212204-66212226 ATAAAAAATACAAAGTTTGAAGG + Intergenic
1109715162 13:66212355-66212377 ATAAAAAATACAAAGCGTGAAGG + Intergenic
1109978143 13:69869905-69869927 ACAAAAAATACTACAATGGAAGG + Intronic
1110583605 13:77161395-77161417 ATAATAAAAACAACAAATGATGG + Intronic
1110916527 13:81028233-81028255 AAAAAAAATACAAACATAAAAGG - Intergenic
1110920273 13:81075601-81075623 TTAAAAAATAAAACCAATGATGG + Intergenic
1111260939 13:85738913-85738935 AAAAAAAATACAACTATGTAGGG - Intergenic
1111405594 13:87800950-87800972 ATAAAAAATAAGACAATTCAAGG + Intergenic
1111462354 13:88561928-88561950 ATAAAAAATACACATATTGGTGG + Intergenic
1111482764 13:88853214-88853236 ATGTAAAAAGCAACCATTGATGG + Intergenic
1111512524 13:89285921-89285943 ATAAAAAATATCACCATTTTTGG - Intergenic
1111713758 13:91851322-91851344 ATAAAAAATACACTCATATAGGG + Intronic
1111776404 13:92668740-92668762 GTAAAAAATACAACTATATAAGG - Intronic
1112392317 13:98996809-98996831 ATAAACAATAAAACCAAGGAAGG - Intronic
1112715328 13:102178383-102178405 ATAAAAAATAAAATAATTAATGG - Intronic
1112977982 13:105344667-105344689 ATATAAAATACATACATTAAGGG - Intergenic
1113029664 13:105979108-105979130 AAAATAAATAAAACCCTTGATGG + Intergenic
1113374048 13:109747321-109747343 ATATAGAATACAATCATTCAAGG + Intergenic
1114346648 14:21803082-21803104 ATTAGACATACAACCATTGGAGG - Intergenic
1114490464 14:23097859-23097881 AGAAAAATTACAACCACTGCTGG + Exonic
1114977930 14:28124838-28124860 ATTAAAAATACAAAAAATGAGGG - Intergenic
1115067928 14:29287761-29287783 AAAGAAAATATATCCATTGATGG - Intergenic
1115389191 14:32835252-32835274 AAAAAAAACACAACTATTGCCGG - Exonic
1115976355 14:39001331-39001353 AGAAAAAAGAAAACCAATGATGG - Intergenic
1116284436 14:42953957-42953979 ATAAAATACAGAACCATTGGAGG - Intergenic
1116299861 14:43164776-43164798 ATGAAAAATACAAAAATTGGCGG - Intergenic
1117365007 14:55018035-55018057 ACAAAAAATACTAGCATTGCAGG + Intronic
1117428157 14:55622640-55622662 AGAAAAAATTAAACCACTGAAGG - Intronic
1117520176 14:56543400-56543422 ATAAAATAAACAACAATTTAGGG - Intronic
1118553741 14:66988645-66988667 ATACCCAAGACAACCATTGAAGG + Intronic
1119055253 14:71412918-71412940 ATAGGAAATACAACCATGGTGGG + Intronic
1119273915 14:73335119-73335141 ATATAAAATGAAAACATTGAGGG - Intronic
1120631109 14:86891360-86891382 ATAAACTATACAACCCTAGATGG - Intergenic
1120875783 14:89374101-89374123 AGAAAAAATACAAAAATTAACGG + Intronic
1122064005 14:99159171-99159193 AAAAAAAAAAAAACCAGTGATGG - Intergenic
1122398481 14:101451981-101452003 ATAAAAAATTCAACCACTTTGGG + Intergenic
1123487826 15:20756724-20756746 ACAAAAAATACAAAAATTGGCGG - Intergenic
1123544325 15:21325800-21325822 ACAAAAAATACAAAAATTGGCGG - Intergenic
1123756909 15:23404013-23404035 AAAAAAAATAGAAGCATTGCAGG + Intergenic
1123913551 15:24996651-24996673 ATAAGAAAAATAACCATTGTGGG + Intergenic
1124902899 15:33841053-33841075 ACAAAAAATACAAAAATTGCTGG + Intronic
1125496222 15:40196937-40196959 AGAAACAGTACAACCATAGAAGG - Intronic
1125497313 15:40208969-40208991 ACAAAAAATACAAAAATTGGTGG - Intronic
1126012099 15:44312782-44312804 CTAAAAAATACAACAATGGCTGG + Intronic
1126112197 15:45181860-45181882 ATAAAAAATAAAACCACGGCTGG + Intronic
1126579011 15:50225652-50225674 ATAAAAAACACCAACATGGATGG + Intronic
1127245025 15:57163740-57163762 CTACAAAATAAAACCATTAAAGG + Intronic
1127647456 15:60972999-60973021 AAAAAAAAAACAATCAATGAGGG + Intronic
1128281822 15:66401444-66401466 TTCAAAAATACAACAATTAAAGG - Intronic
1128872238 15:71169266-71169288 ATAAAAAACACTACCAGTGTTGG + Intronic
1129017945 15:72485598-72485620 ATAAAAAACAAAACCATTCAGGG - Intronic
1129031947 15:72625388-72625410 ATACAAAATAGAACCTTTGGAGG - Intergenic
1129217981 15:74111982-74112004 ATACAAAATAGAACCTTTGGAGG + Intronic
1129277416 15:74455822-74455844 ACTAAAAATACAAAAATTGAAGG + Intronic
1129406577 15:75323161-75323183 ATACAAAATAGAACCTTTGGAGG - Intergenic
1129550443 15:76443031-76443053 GTAAAAAACACCACCACTGAGGG + Intronic
1129735110 15:77956120-77956142 ATACAAAATAGAACCTTTGGAGG + Intergenic
1130114582 15:80995793-80995815 ATAGAAAATACATCCAAAGATGG + Intergenic
1130993281 15:88889496-88889518 ACAAAAAATACAAAAATTAATGG - Intronic
1132164325 15:99570813-99570835 AAAAAAAAAACAACTTTTGAAGG + Intronic
1202952670 15_KI270727v1_random:53072-53094 ACAAAAAATACAAAAATTGGCGG - Intergenic
1133727202 16:8548710-8548732 AAAAAAAATACACCCATATATGG + Intergenic
1134194133 16:12145596-12145618 ATAAATAATAAATTCATTGATGG - Intronic
1135084771 16:19466512-19466534 ATTAAAAATACAAACATTAGCGG - Intronic
1135628775 16:24019465-24019487 TTAAAAAATACAACCTTGGTCGG + Intronic
1135649671 16:24195039-24195061 ACAAAAAATACAAACGTTGGTGG + Intronic
1135989903 16:27211838-27211860 ATTAAAAATACAAAAATTGCCGG - Intronic
1136506239 16:30705363-30705385 ATAAAAAATAAAAACATTGCTGG - Intronic
1137516272 16:49147313-49147335 AAAAAAAATACACCTCTTGATGG + Intergenic
1138154199 16:54687333-54687355 AAAAAAAAAGCAACCATTAAAGG + Intergenic
1138564961 16:57826283-57826305 GAAAAAAGTACAACCATAGAAGG - Intronic
1138825204 16:60310621-60310643 AAAATGAATAAAACCATTGATGG + Intergenic
1138964265 16:62065085-62065107 ATAAAAAATAAAAACATTCTAGG - Intergenic
1140083536 16:71773923-71773945 ATACAAAATACAAAAATTAATGG - Intronic
1140198205 16:72873138-72873160 GTGAAAAATACGCCCATTGAAGG - Intronic
1141112282 16:81279943-81279965 ATTAAAAATACAACAGATGATGG - Intronic
1143655632 17:8291885-8291907 ATTAAAAATACAAAAATTGCCGG + Intronic
1143765923 17:9137799-9137821 AAAAAAAATAAAACTGTTGACGG + Intronic
1143842985 17:9749409-9749431 ATAAAAAATATAACAAGTCATGG - Intergenic
1143879701 17:10020613-10020635 AAAAAAAAAACAACCATGGCCGG + Intronic
1144031068 17:11323991-11324013 ATAACAAATAAAATGATTGAGGG + Intronic
1144263070 17:13542163-13542185 ATAAAAAATACAAAAATAGCTGG + Intronic
1144383525 17:14726993-14727015 ATAAGAAATACAACCAGGCAGGG - Intergenic
1147001269 17:37364133-37364155 ATAAAAAATAAAAAAATTGCTGG + Intronic
1147502348 17:40977436-40977458 ATAAAAAATAAAAAAAGTGATGG + Intergenic
1148032450 17:44630718-44630740 ACAAAAAATACAAAAATTAACGG - Intergenic
1149177210 17:53887437-53887459 CTAAAAACTACAAACACTGATGG + Intergenic
1149309360 17:55379032-55379054 ATAAAAAGTATCACCCTTGAAGG + Intergenic
1149898890 17:60455390-60455412 TTAAAAAATACAAACCTAGAGGG + Intronic
1150054867 17:62005307-62005329 ATTAAAAATAAAATCATAGATGG + Intronic
1150424745 17:65068361-65068383 ATTAAGAATAGGACCATTGAGGG - Intergenic
1150500556 17:65647066-65647088 TTCAAAAATCCAACCAGTGAAGG + Intronic
1150947267 17:69761598-69761620 ATGAAAAATATAATAATTGAGGG + Intergenic
1151070001 17:71198382-71198404 ACAAAAGAGAAAACCATTGAAGG - Intergenic
1151988803 17:77560857-77560879 ATAAAATATATAACGATTCATGG + Intergenic
1153340738 18:3972180-3972202 ATAAAAAATACAACACCTCAAGG + Intronic
1154038162 18:10826962-10826984 GTGAAAAATCCAACCTTTGAAGG - Intronic
1155030144 18:21977212-21977234 AAAAAAAAATCAACCATTTAAGG - Intergenic
1155481500 18:26292885-26292907 ATAAAAAAAGCAACTATTCATGG + Intronic
1155609341 18:27646460-27646482 ACATAAAAAACAACCATTAATGG + Intergenic
1155641995 18:28029442-28029464 ATTAAAAAAAAAACCAATGATGG - Intronic
1156033930 18:32745070-32745092 AGAAAACACACAGCCATTGAGGG - Intronic
1156430503 18:37068276-37068298 ATATAAAATATAACAAGTGATGG + Intronic
1156579017 18:38353872-38353894 TTAAAAAATGCAACCAATGAGGG + Intergenic
1156750735 18:40451403-40451425 ATAAAGAAGACAACAATTAATGG + Intergenic
1157656677 18:49396682-49396704 TAAAAAAATTCATCCATTGATGG - Intronic
1157760051 18:50255468-50255490 ATGTAAGATATAACCATTGAGGG + Intronic
1157832305 18:50867682-50867704 ATAAAAAATAAAAACATTTCTGG - Intergenic
1158075806 18:53527513-53527535 ATATAAAATAAAAAAATTGAAGG + Intronic
1158822333 18:61175632-61175654 GTAAAAAAAAAAACCATTAAAGG + Intergenic
1159384343 18:67703961-67703983 ATAAAAATAAAAACCATTTAGGG + Intergenic
1159434727 18:68401020-68401042 ATCAGAAATATAACAATTGAAGG + Intergenic
1159518864 18:69493791-69493813 AAATAAAATAAAACCATTGTGGG - Intronic
1160047091 18:75396627-75396649 ATAAACATTAAAACCAGTGATGG + Intergenic
1160263914 18:77322075-77322097 ATACAGAAAACAACCATGGAAGG - Intergenic
1160434981 18:78843862-78843884 ATAACAATTACAAACATTTATGG - Intergenic
1161036658 19:2088762-2088784 ACAAAAAATACAAAAATTGCCGG - Intronic
1162700444 19:12511204-12511226 ATAACAACTACAACCACAGAAGG + Intronic
1163096662 19:15063045-15063067 ATAAAAAAAAGAAACACTGAAGG - Intergenic
1163705726 19:18811933-18811955 CTAAAAAATACAAAAATTAACGG - Intergenic
1164638812 19:29810846-29810868 ATAAAAAATACAAGTCTTGAGGG + Intergenic
1165184173 19:34002504-34002526 ATTAAAAATACAAACATTAGTGG - Intergenic
1165463867 19:35960448-35960470 AGTAAAAATACAAAAATTGAGGG - Intergenic
1166949282 19:46415784-46415806 CTAAAAAATACAAAAATTGCCGG + Intergenic
1167370117 19:49075721-49075743 ACTAAAAATACAACAATTGTAGG - Intergenic
1167405926 19:49308579-49308601 CTAAAAATTGCAAACATTGAAGG - Intronic
1167444483 19:49529197-49529219 ATAAAAAAGAGGACCTTTGAGGG + Intronic
1167639834 19:50674763-50674785 ATAAAAATTACAAAAATTGCTGG + Intronic
1168231763 19:55037034-55037056 AAAAAGAATACATCCATGGATGG + Intronic
1168506046 19:56935961-56935983 ATAAAAAATACAACATTTGCCGG - Intergenic
1168672014 19:58247694-58247716 ATTAAAAATACAAAAATTAATGG - Intronic
925344457 2:3160804-3160826 CTAACAAATACAATCTTTGATGG - Intergenic
925758843 2:7164227-7164249 AGAAAAAATACAAACATGGATGG - Intergenic
925946565 2:8869558-8869580 ATAAACAATAAAACAATTTAAGG - Intronic
926611239 2:14950428-14950450 ATAAAAAACACAAATATTTAAGG + Intergenic
927599844 2:24431254-24431276 AAAAAAGAGACAACCATGGATGG - Intergenic
928070820 2:28214037-28214059 ATATAAAATATCACCAATGAGGG - Intronic
928249585 2:29663487-29663509 AGAAAGAGTACAACCAGTGATGG + Intronic
928708955 2:33982793-33982815 ATGAACAATACAAACATTAATGG + Intergenic
928788348 2:34918317-34918339 AAAAAAAATCCAACCATAAAAGG - Intergenic
928844671 2:35656595-35656617 AAAAAAAATAAAACGATAGAAGG + Intergenic
928971137 2:37030646-37030668 ATAATAATTACAACCAGTGTTGG - Intronic
929459689 2:42093753-42093775 AAAAAAAAAAAAGCCATTGAAGG + Intergenic
929506208 2:42530192-42530214 AAAAAGATTACAACCATTGCCGG + Intronic
930013180 2:46953453-46953475 ATAGAAAATACTACAAATGATGG - Intronic
930160458 2:48150280-48150302 AAAAAAAATTCAAGCATTCATGG + Intergenic
930364749 2:50425101-50425123 ATAAAAAATACCAAACTTGATGG + Intronic
930803965 2:55471534-55471556 ACTAAAAATACAAACATTGGTGG + Intergenic
931074538 2:58694855-58694877 TTTAAAAATACAAAAATTGAAGG - Intergenic
931077056 2:58727111-58727133 ATAAAAAATAAAAAAACTGAAGG - Intergenic
931328805 2:61257927-61257949 ATAAAATATACAACCTTTACAGG + Intronic
931414651 2:62069636-62069658 CCAAGAAATACAACCAGTGAGGG - Intronic
931620181 2:64202021-64202043 ATAAAAAGTACAAACAGCGAAGG + Intergenic
932147418 2:69335167-69335189 ATAAAAAATACAAAAATTAGCGG - Intronic
933082401 2:78007080-78007102 ATGAAAAATAAAACCAGAGATGG - Intergenic
933453446 2:82489867-82489889 ATTAAAAATATACACATTGATGG - Intergenic
933471049 2:82724168-82724190 TTAAAAAATAGAAATATTGACGG - Intergenic
934021092 2:87953313-87953335 ATAAACAATACAAATATGGAGGG + Intergenic
934065695 2:88339200-88339222 ACAAAAAATACAAACATAGTTGG - Intergenic
934183277 2:89648805-89648827 ATAAAAAGAATAATCATTGAAGG + Intergenic
935391413 2:102557151-102557173 ATAAACAATACAAACATTTAGGG - Intergenic
935448203 2:103179395-103179417 ATAATAAATACAATCAGAGAGGG + Intergenic
935830292 2:106995112-106995134 ATAAAAAATAGAATCAGTGAAGG + Intergenic
935957917 2:108397160-108397182 AAAAAAAAAACAACACTTGAAGG + Intergenic
936176352 2:110224251-110224273 GTAAAAAACACTACCATTTATGG - Intergenic
937489808 2:122354170-122354192 ATTAAAAAGACAACAATTAATGG + Intergenic
937548868 2:123061296-123061318 ATATAAAATACAATCTTTGTAGG - Intergenic
937955400 2:127419186-127419208 ATTAAAAATCCAACCCTTGCTGG - Intronic
938823690 2:134983514-134983536 ACAGAAAATCCAACCACTGAGGG - Intronic
938906728 2:135843741-135843763 AAAAAAAACAAAACCATTCAGGG + Intronic
938910802 2:135884309-135884331 AAAAAATATACATTCATTGAAGG + Intergenic
939191653 2:138923761-138923783 AAAGAAAATACAACAATTAAGGG + Intergenic
939453681 2:142404999-142405021 ATAAAAAAGAAAACATTTGAGGG + Intergenic
939455099 2:142423688-142423710 GTAAAAAATACAACCCTGGATGG - Intergenic
940177038 2:150889924-150889946 ACAAAGAATACAACCTTTGATGG - Intergenic
940406254 2:153305790-153305812 ATAAAAAATAAAACCTGTCATGG - Intergenic
940444370 2:153759964-153759986 ATATAAAAAATAACCATTAAAGG - Intergenic
940777963 2:157904227-157904249 AAAAAAATTACATGCATTGATGG + Intronic
941062906 2:160868432-160868454 AGAAAATATAGATCCATTGAGGG - Intergenic
941388556 2:164883034-164883056 AGTAAAAATACCATCATTGAAGG - Intergenic
941654559 2:168129146-168129168 ATAAAAAACACAACTTTTAATGG - Intronic
941873002 2:170405184-170405206 ATATAAAAGAAAACCACTGAGGG - Intronic
941927267 2:170908683-170908705 ACAAAAAATACAAATATTGGCGG + Intergenic
942424434 2:175844781-175844803 CAAAAAAATACAACCAATGTTGG - Intergenic
942471275 2:176263348-176263370 ATATATAATACTTCCATTGAAGG + Intergenic
943608838 2:190007962-190007984 ATAAAAAAGAGAAATATTGAAGG + Intronic
943638539 2:190333480-190333502 ATCAAAAATACAATATTTGAGGG + Intronic
944454064 2:199875469-199875491 ATAAAAAATATAAATATTGCAGG - Intergenic
944778761 2:202995936-202995958 ACAAAAAATACAAAAATTAATGG + Intronic
945450228 2:209985936-209985958 AAAAAAAATACACCCGATGATGG - Intronic
945565632 2:211395466-211395488 ATAAAAAATGCAACCTCTAAAGG - Intronic
946359740 2:219212057-219212079 ACAAAAAATACAAAAATTGCTGG - Intronic
946980425 2:225207963-225207985 TTTAAAAAAACAACCATCGATGG + Intergenic
947174885 2:227355690-227355712 AATATAGATACAACCATTGAAGG + Exonic
947242199 2:228007201-228007223 ATAATAATTACATCCATTTATGG + Intronic
947350046 2:229234181-229234203 ATAAAACCTAAAACCATGGAGGG + Intronic
947409637 2:229822799-229822821 ATTAAAAATACAAGCAAAGATGG + Intronic
947725587 2:232397629-232397651 ATAAAAAATAAAAACATGGCCGG - Intergenic
948210570 2:236190215-236190237 ACAAAAAATAAAAAAATTGATGG + Intergenic
948432602 2:237929602-237929624 CTAAAAAATACAAAAATTAAAGG - Intergenic
1168754634 20:307893-307915 ATAAAAAATAAGAACTTTGATGG + Intergenic
1169056023 20:2621673-2621695 ATAAAAAATAAAACCCCTAATGG + Intronic
1169121152 20:3096585-3096607 ATAAAAAATAAAATCTTTGCCGG - Intergenic
1169299365 20:4428744-4428766 ATAAAAAATACAAAATTTGCTGG + Intergenic
1169322759 20:4647721-4647743 ATAAAAAATACAATATTTGGGGG + Intergenic
1169560480 20:6794620-6794642 ATACAAGATATAACCATTGGGGG - Intergenic
1169746308 20:8946540-8946562 ATAAAAAATAAAAACACTGTCGG + Intronic
1170197801 20:13707986-13708008 TTTCAAAATACTACCATTGAGGG - Intergenic
1170653077 20:18260586-18260608 AAAAAAAAAAGTACCATTGAAGG - Intergenic
1171079964 20:22170444-22170466 ATAAAAAATAATACCATGAATGG - Intergenic
1171321832 20:24252388-24252410 AGAAAAAATACAACAATCAAAGG + Intergenic
1172975824 20:38905082-38905104 ATAGATAATACATCCAATGAGGG - Intronic
1173611223 20:44369794-44369816 ATTAAAAATACAAAAATTGCTGG - Intronic
1174321391 20:49744446-49744468 ATAAATAATACAGCCAGTCATGG + Intergenic
1174598444 20:51703813-51703835 ATGAAAAATACAAGTATAGATGG - Intronic
1174937863 20:54892244-54892266 ATGAAAAATACCACCATCTATGG - Intergenic
1175028009 20:55923404-55923426 ATAAAAAATACTACCTGAGAAGG - Intergenic
1175038723 20:56025280-56025302 ATAAAAAATAGAATGATGGAGGG + Intergenic
1176283184 20:64327061-64327083 GTAGAAAAGAGAACCATTGAAGG - Intergenic
1177060112 21:16361873-16361895 ATAACAATTACAACAATTCATGG + Intergenic
1177425642 21:20919368-20919390 AGAAAAAATGCATGCATTGAAGG - Intergenic
1177842211 21:26247174-26247196 ACAAAAAATAAAACAATTAAAGG + Intergenic
1178150028 21:29783551-29783573 CTAAAAAATAAAACCATATAAGG - Intronic
1178205386 21:30458121-30458143 AAAAAAAATACAAAAATAGACGG - Intergenic
1178375720 21:32065982-32066004 AGAAATAATATAACCCTTGAGGG + Intergenic
1178489436 21:33039591-33039613 AGGATAAATACAACCACTGAGGG - Intergenic
1178551749 21:33546241-33546263 GAAACAAATACACCCATTGAAGG + Exonic
1178945739 21:36946229-36946251 ATAAAAAATAAAAAAGTTGAGGG - Intronic
1179314377 21:40228594-40228616 ATAAAATAAACAAGCAATGATGG - Intronic
1179381026 21:40899235-40899257 ATAAAACATAAAGCCATTTATGG + Intergenic
1179453172 21:41479487-41479509 ATAAGAAACACGACCAATGAAGG - Intronic
1179829053 21:43984667-43984689 AAAAAAAATTCAAACATTCATGG - Exonic
1181597954 22:23929642-23929664 ACTAAAAATGCATCCATTGATGG - Intergenic
1181924891 22:26350388-26350410 ACAAAAAATACAAAAATTAATGG - Intronic
1182312305 22:29417929-29417951 AAAAAAAAAAAAACCATTCAAGG - Intronic
1182740220 22:32562202-32562224 ATAACAAATAGCACCATTGCTGG + Intronic
1184118770 22:42437302-42437324 CTAAAAAATACAAACATAGCCGG - Intergenic
950064748 3:10103100-10103122 AAAAAAAATACAAAAATTAATGG + Intronic
950512909 3:13443398-13443420 ATAAAAAATACACTCTGTGATGG - Intergenic
950988216 3:17400103-17400125 CTAAAATATACAACCTGTGATGG + Intronic
951142105 3:19174868-19174890 AGAAACAAAACAACCATGGATGG - Intronic
951478576 3:23135037-23135059 ATAAAAAATACAGACAAAGAAGG + Intergenic
951549681 3:23864435-23864457 AGAAAAGATACAACAATTAAAGG - Intronic
951617463 3:24563792-24563814 TTAAAAAACACAACCATTAAAGG - Intergenic
951744863 3:25966767-25966789 AAAAAAAAGAAAAACATTGAGGG - Intergenic
951921890 3:27863948-27863970 AGAAAAAATACAACAAGTGTTGG - Intergenic
952192197 3:31035601-31035623 ATAAAGAGTACAACTAGTGATGG + Intergenic
952380593 3:32801471-32801493 ACAAAAAATACAAAAATTGCTGG - Intergenic
952598343 3:35046268-35046290 ATAGAAAATACACTCATTTAGGG - Intergenic
954012876 3:47658296-47658318 ATATAAAATTCACCCATTGAAGG + Intronic
954302852 3:49709733-49709755 ACAAAAAATACAAAAATTGCAGG - Intronic
955546125 3:60032468-60032490 ATAAAAAATAAAAACATTATTGG + Intronic
955659376 3:61280322-61280344 ATAAAAAATATAAAAATTGTGGG - Intergenic
955704016 3:61709613-61709635 ATTTAAAATGCAACCATTTAAGG - Intronic
955809777 3:62775352-62775374 TTAAAAAATAAAACCACTTACGG - Intronic
956154777 3:66283693-66283715 ATAATAAATAAAACCATTATGGG - Intronic
957007651 3:74969067-74969089 AAAAAAAATACTAACATTGTGGG + Intergenic
958969272 3:100593038-100593060 CTAAAAAATACAAAAATTGCTGG + Intergenic
959310689 3:104732532-104732554 ATCAAAATTAAAACAATTGATGG - Intergenic
959587993 3:108043440-108043462 ATAAAAAAAAAAACCTTTAACGG + Intronic
959666015 3:108922492-108922514 ATAAAAAAAACAACAAATGTTGG - Intronic
959672843 3:108998427-108998449 ATAATAAATACCACCTTTGGGGG + Intronic
959859392 3:111199634-111199656 ATAATAAATACAACCAATTTAGG - Intronic
959995136 3:112672284-112672306 AAAAAAAAAAAAGCCATTGAAGG + Intergenic
960004119 3:112764517-112764539 ATAAAAAAAAAAACCAGTGGTGG + Intronic
960291238 3:115887934-115887956 ATATAAAATCAAACTATTGACGG + Intronic
960309592 3:116104928-116104950 ATAAAACATACAGCCATGGCAGG + Intronic
960771827 3:121201643-121201665 AAAAAAAAAACAACCAGTAACGG - Intronic
961148141 3:124612497-124612519 ATTAAAAATACAAAAATTGCTGG - Intronic
961874968 3:130015373-130015395 ATAAAAAGGACAACCAGTGGGGG + Intergenic
962164044 3:133030393-133030415 ATAAAAATAACAACCATTAGAGG - Intergenic
963652562 3:148000628-148000650 TTAAAAAACATAACCATTTACGG + Intergenic
963819653 3:149875158-149875180 ATACATAATACTACAATTGATGG + Intronic
964227098 3:154417310-154417332 ATAAAATTTACAAGAATTGAAGG - Intronic
965052848 3:163672391-163672413 TTAAAAAATAGAGACATTGAAGG - Intergenic
965166549 3:165200700-165200722 AAAAAAAAAAAAACAATTGATGG - Intergenic
965882982 3:173409801-173409823 ATAAAAAAGACAAGTATTGATGG + Intronic
966203495 3:177381022-177381044 TTAAAAAAGAAAACCATTGCTGG - Intergenic
966622100 3:181976499-181976521 ATAAAATATACAAGTATAGAAGG + Intergenic
966929624 3:184667591-184667613 ATAAAAAATAAAAAAATTGCCGG + Intronic
967468966 3:189840869-189840891 AAAAAAAAAACAACTATTCAAGG + Intronic
967647084 3:191938649-191938671 ATAAATAAATCAATCATTGATGG - Intergenic
970012742 4:11478107-11478129 ATATAAAATAAAACAAGTGAAGG + Intergenic
970314365 4:14815305-14815327 ATAAAAAATAAAAACAGGGAGGG + Intergenic
970821054 4:20214595-20214617 AAAAAAAAAAAAAACATTGAAGG - Intergenic
971168260 4:24206526-24206548 ATAAAAAATACTAACATTGGAGG + Intergenic
973104633 4:46320043-46320065 ATACATAAAACAACCCTTGAAGG + Intronic
973577476 4:52305037-52305059 TTAAAAAATAAAACCATTAGAGG + Intergenic
973894857 4:55401814-55401836 ATTAAAAATAAAATCAATGAAGG + Intronic
974421548 4:61683100-61683122 AAAAAAAATACAGCTCTTGAAGG - Intronic
974490872 4:62562957-62562979 ATTAAAAATAAAAGCATAGAAGG - Intergenic
974500530 4:62695037-62695059 ATAAAATAGACAACCATTAAAGG + Intergenic
975257729 4:72257163-72257185 ATAAATAGTACAACAAGTGATGG - Intergenic
976640234 4:87330067-87330089 AAAAAAAACAAAACCATGGATGG - Intergenic
976906549 4:90243541-90243563 ATAAAAAATAAAAACATGGCCGG - Intronic
977158650 4:93606365-93606387 AGAAATAATACAGCCATTTAGGG + Intronic
977196765 4:94072275-94072297 ATAAAAAATAAAAGTATAGATGG + Intergenic
977709239 4:100105850-100105872 CTATCAAATACAACCATTGAAGG + Intergenic
978555697 4:109978011-109978033 ATGACTAATACAACTATTGAAGG + Intronic
978839461 4:113192932-113192954 AAAAAAAAAACAACCCTTGATGG + Intronic
978852966 4:113360001-113360023 ATAAAAAAGGAAACCATAGATGG + Intronic
979881620 4:125966056-125966078 ATGAAATATATAAACATTGAGGG - Intergenic
979896070 4:126158389-126158411 ATGAAAAGTACATCCAATGAAGG - Intergenic
979938413 4:126726753-126726775 AAAAAAGAAACAAACATTGAGGG + Intergenic
980337422 4:131494786-131494808 ATTAAAAATACAAAAATTAACGG - Intergenic
980440320 4:132835280-132835302 ATAAACAATCCCACCACTGAAGG - Intergenic
980549080 4:134309551-134309573 ATAAATAAAGCTACCATTGAAGG - Intergenic
980584956 4:134800248-134800270 ATAAAAAATAGAAACTCTGAGGG - Intergenic
981037877 4:140191127-140191149 ATCAAAGATATAACCATAGAAGG + Intergenic
981050379 4:140303863-140303885 ATAAAGAAAACAAGCATTGCCGG + Intronic
981144647 4:141310181-141310203 AAATAAATCACAACCATTGAGGG + Intergenic
981904676 4:149908529-149908551 ATAACAAATATAACCATCAAGGG + Intergenic
981918697 4:150063021-150063043 ATAAAAGATACAAGCAATTATGG - Intergenic
982993477 4:162310244-162310266 ATAAAACATACCACCATGAAAGG + Intergenic
983309044 4:166033547-166033569 TTAAAAAATACAGTCATTGTAGG + Intronic
983614629 4:169688556-169688578 ATAAAAAATACACAAATTTATGG - Intronic
984062391 4:175006252-175006274 ATAAAGAAAACAACCATTTTGGG - Intergenic
984334574 4:178373794-178373816 ATAAAAAATACAACAACAAAGGG - Intergenic
984379278 4:178969871-178969893 AGAAAAAATATAAACATTGGTGG - Intergenic
984861629 4:184245627-184245649 ATAAAGAAAACAATCATTGGAGG + Intergenic
984922996 4:184782268-184782290 AAAAAAAAAACAACCCTTTAAGG + Intronic
985898096 5:2762365-2762387 ATAAAAAAGAGAAAAATTGAAGG + Intergenic
985985663 5:3514066-3514088 ATAAAAAACAGAACTATTGGAGG - Intergenic
986236983 5:5920074-5920096 AAAAAAAAAAAATCCATTGAAGG + Intergenic
986367662 5:7049842-7049864 AAAAAAAATTCAAACAATGAAGG + Intergenic
986447501 5:7835463-7835485 CTTAAAAATACAATCATAGAGGG + Exonic
987767321 5:22249668-22249690 ATAAAAAACACAAACATAGCAGG + Intronic
987974541 5:24996070-24996092 ATAAAAAAAACAACCCAGGATGG + Intergenic
988120935 5:26961407-26961429 TTAAAAATTATAACCATTGAGGG - Intronic
988146259 5:27312592-27312614 GTAAAAAATACACCCATGGCTGG + Intergenic
988175521 5:27718739-27718761 ATAAGAAATACAATCAAAGAAGG + Intergenic
989093403 5:37757829-37757851 ATAAAAAAGAAAAAAATTGAAGG - Intergenic
989377298 5:40777770-40777792 CTAAAAAATACAAAAATTAATGG + Intronic
989689266 5:44120901-44120923 ATGAAAAATACAATCAATTAAGG + Intergenic
989699818 5:44249689-44249711 ATAAAAATTAATTCCATTGAAGG - Intergenic
989807781 5:45632044-45632066 ATAAAAAATAAAAGCAATTAAGG - Intronic
990085153 5:51967528-51967550 ATAAAAAATACATAAATTTAAGG - Intergenic
990280825 5:54249055-54249077 ATAAAAAAAAGAATCAGTGATGG + Intronic
991085244 5:62642934-62642956 ATTAAAAATACACACGTTGAAGG - Intergenic
991100606 5:62788320-62788342 ATAAACAAAACAACTATAGAAGG - Intergenic
991440436 5:66641765-66641787 ATAAAAATAACAACTATAGAGGG + Intronic
991590489 5:68246607-68246629 ATAAAAAAGACACACATGGACGG - Intronic
991730182 5:69578347-69578369 ATAAAAAATACAACAATATATGG - Intronic
991806616 5:70433505-70433527 ATAAAAAATACAACAATATATGG - Intergenic
991864771 5:71049501-71049523 ATAAAAAATACAACAATATATGG + Intronic
992024941 5:72660881-72660903 ATTAAAAATACAACCATATTAGG + Intergenic
992428672 5:76685757-76685779 ATAAAAAATAAACCCACTGCTGG - Intronic
993040264 5:82806231-82806253 ATAAAAACTACAAACATGGCTGG - Intergenic
993056281 5:82983716-82983738 ATAAAAAAGACAAATATTTAAGG + Intergenic
993275157 5:85848058-85848080 ATAAAATATTTAACCATTGTAGG + Intergenic
993669874 5:90747439-90747461 ATACAAAATAAAATCATTGAAGG + Intronic
994630658 5:102282503-102282525 ATAAAAAATATAACAAAGGAGGG + Intronic
994817346 5:104600998-104601020 ATAAAAAAGACAAATATTTAAGG - Intergenic
995201622 5:109431003-109431025 ATAAAAAATAAAAGCCTTCAGGG - Intergenic
995628087 5:114101400-114101422 AAAAAAAAGAAAACCATAGATGG - Intergenic
996175869 5:120356181-120356203 ATAGAAAATACAAGTATTGTAGG - Intergenic
996955631 5:129180154-129180176 ATAAAATATACAAACATATATGG - Intergenic
997938121 5:138132195-138132217 ACAAAAAATACAAAAATTGGTGG + Intronic
998075185 5:139230515-139230537 ACAAAAAATACAAAAATTCATGG + Intronic
998916795 5:147021939-147021961 ATAAAACATAAAAATATTGAGGG + Intronic
1000126533 5:158249995-158250017 AGTAAAAATAAAACTATTGAAGG - Intergenic
1000531786 5:162431048-162431070 ATAAAACATTCAATAATTGAAGG - Intergenic
1000636733 5:163652575-163652597 ACAAAACATACTACAATTGATGG - Intergenic
1002346378 5:178550592-178550614 GTAAAAAATACAACCATGGCTGG - Intronic
1002386765 5:178873906-178873928 ATGAAAACTACAAACACTGATGG - Intronic
1002682518 5:180978424-180978446 ATACAAAATACAAACTTTGCTGG - Intergenic
1002705291 5:181157166-181157188 AAAAAAAATATCTCCATTGAAGG + Intergenic
1002842082 6:914640-914662 ATAAATACTACAACCAATGTTGG - Intergenic
1002894707 6:1370264-1370286 ATAAAAAATACTACCCTTCTGGG + Intergenic
1003892117 6:10572754-10572776 ATAAAAAATAAAAGGATAGATGG + Intronic
1004517694 6:16334754-16334776 ATAAATACTGCAACCATAGATGG + Intronic
1005041632 6:21605766-21605788 ATTAAAAATACAAAAATTGTTGG + Intergenic
1005205487 6:23398486-23398508 ATAATAAATCCAACCAAGGATGG + Intergenic
1006468484 6:34211230-34211252 ACAAAAAATACAAAAATTGCTGG + Intergenic
1007762677 6:44142275-44142297 AAAAAAAAAAAAATCATTGAGGG + Intronic
1010081994 6:71874486-71874508 ATATAAAATGTCACCATTGAGGG - Intergenic
1010155972 6:72793321-72793343 AAAAAAAATCACACCATTGATGG + Intronic
1010913464 6:81587244-81587266 ATAAAAAAAACAACAGTAGATGG - Intronic
1012301211 6:97590911-97590933 ATAAAAAATAAAATCATTTTGGG - Intergenic
1012394638 6:98782134-98782156 ATAAAAAATACCACCAATCTGGG - Intergenic
1012683650 6:102215240-102215262 ATAAAAATTGCAAACATGGAAGG - Intergenic
1013045302 6:106479583-106479605 ATAAAAAAGACAACGAGTGTTGG - Intergenic
1013105641 6:107024567-107024589 AAAATAAATAAAAACATTGATGG + Intergenic
1014779026 6:125542075-125542097 ATAACAAATACCACCCTGGATGG + Intergenic
1015171263 6:130256730-130256752 ATAAAAAATAAAACATTTTATGG + Intronic
1015222269 6:130817511-130817533 AAAAAAAATACAATAAGTGAAGG + Intergenic
1015977657 6:138807133-138807155 CAAAAAAATACAACCATTAGTGG - Intronic
1016192104 6:141282100-141282122 AAGAAAAATAAAACCATGGATGG + Intergenic
1016760770 6:147734166-147734188 ATAAAAACTAAAACCACTTAAGG - Intronic
1016819922 6:148337522-148337544 ATAAAAAATACAGAAATTAAGGG - Intronic
1017143266 6:151211271-151211293 ATAAAAGACACATACATTGATGG + Intergenic
1017161574 6:151370555-151370577 ATCAAAAATAAAACCACTGAGGG - Intronic
1017358498 6:153538542-153538564 ATATAAAATACAAACAGTCAGGG + Intergenic
1017786294 6:157759836-157759858 ACAAAAAAAACAAACTTTGATGG - Intronic
1018152387 6:160952579-160952601 ATAAAAAATAAATCTATTCAAGG + Intergenic
1018508084 6:164493117-164493139 TTAAAACATACAACCTTGGAGGG + Intergenic
1019971567 7:4545432-4545454 ATTAAAAATACAACAATTGTAGG - Intergenic
1022789950 7:33677288-33677310 ATAACAAATGCAACAATTGGAGG - Intergenic
1022900675 7:34807457-34807479 ATAAAAGATACAACACATGATGG - Intronic
1023421520 7:39985065-39985087 ACAAAAAATACAAAGAATGAAGG - Intronic
1023569296 7:41555769-41555791 TTGAAAAAGACAACCATTAATGG - Intergenic
1023688459 7:42761939-42761961 ATAAAAAATATCAGCATTGTTGG - Intergenic
1025839807 7:65135606-65135628 ACAAAATATAAAACCATTTACGG + Intergenic
1025883259 7:65560360-65560382 ACAAAATATAAAACCATTTAAGG - Intergenic
1025890187 7:65642247-65642269 ACAAAATATAAAACCATTTACGG + Intergenic
1026112875 7:67472392-67472414 ACAAAAAATACAAAAATTAACGG + Intergenic
1026172711 7:67968430-67968452 ACAAAAAATACAAAAATTGCTGG - Intergenic
1027381477 7:77614179-77614201 TTAAAAAATACAACAATAGCTGG - Intronic
1027487649 7:78781911-78781933 TTAAGAAATATAACAATTGAAGG - Intronic
1027587247 7:80074142-80074164 TTAAAAAATCCATCCATTGATGG - Intergenic
1027930404 7:84525922-84525944 AAAAAAAATACACACAATGAGGG + Intergenic
1028110907 7:86940009-86940031 GTAAAAAATATCACAATTGAAGG - Exonic
1028485464 7:91352651-91352673 AAAAAATATATTACCATTGAAGG + Intergenic
1028666721 7:93352687-93352709 ACCAAAAACACATCCATTGAAGG + Intronic
1028874104 7:95801248-95801270 ATAAACAATAAAAACATTGAGGG - Intronic
1030464031 7:109877068-109877090 AAAAAAGATATTACCATTGAGGG + Intergenic
1030550646 7:110954822-110954844 GTAGAAAATAAAACCATTCAAGG + Intronic
1031001073 7:116415414-116415436 ATAAAATATACAACTATACATGG - Intronic
1031176251 7:118355235-118355257 ATAAAATATATAACAATTTATGG - Intergenic
1031688255 7:124759227-124759249 ACAAAAAATACAAAAATTAACGG - Intronic
1031825998 7:126566517-126566539 ATCAAAAAAACAACCAATGTTGG + Intronic
1031852296 7:126879743-126879765 ACAAAATATAAAACCATTTAAGG - Intronic
1031874916 7:127128534-127128556 ACAATAATTACTACCATTGAAGG - Intronic
1031881428 7:127203121-127203143 ATAAATGAAACAACCATTTATGG + Intronic
1032419786 7:131769010-131769032 ACAAAAAATACATGCATTGTGGG + Intergenic
1033170269 7:139077650-139077672 ATACAAAAGACAGCCATTGCAGG + Intronic
1033783158 7:144696970-144696992 AGTAAAAATACAATGATTGAGGG - Intronic
1034854265 7:154526203-154526225 ATAAAGAAGACAACCACTGTGGG - Intronic
1035963774 8:4167564-4167586 AGCAAAAATTCAACCATTTAAGG + Intronic
1036821087 8:11940681-11940703 ATAAAAAATAAAAAAAGTGATGG + Intergenic
1037459492 8:19094737-19094759 ATTAAAAGTACAACCATGGCTGG + Intergenic
1038091853 8:24263124-24263146 ATAAAATATAGAAACATTAAAGG - Intergenic
1038156310 8:24994009-24994031 AGGAAAAATACTACCTTTGATGG - Intergenic
1039091804 8:33837959-33837981 AGAAAAAATAAAAATATTGAAGG + Intergenic
1041366587 8:57112305-57112327 ACAAAATATACAACAAATGAGGG + Intergenic
1041703792 8:60822752-60822774 ACAAAGAATACAACCTGTGAAGG - Intronic
1043205997 8:77441183-77441205 ATTAAAAATGAAACCATTGTAGG - Intergenic
1043541970 8:81274384-81274406 CTAAAAACTACATCCATTGTGGG - Intergenic
1044417701 8:91954721-91954743 ATAAAAAAAATAACATTTGAAGG - Intergenic
1044600739 8:94001510-94001532 ATAAAAAATATAAACATTAAGGG - Intergenic
1044651430 8:94499884-94499906 AAAAAAAATACAAAAATTAACGG + Intronic
1045127629 8:99110384-99110406 AATAAAAATAAAACAATTGATGG - Intronic
1045171168 8:99670358-99670380 ACAAAAATTACAAACATTTAAGG + Intronic
1045524723 8:102931928-102931950 ACAAAAAACAAAACCACTGAGGG - Intronic
1045752207 8:105498215-105498237 ATAAAAAATCCAACAATTTAAGG + Intronic
1046449917 8:114375346-114375368 AGAAAAAATACAAACAGAGAGGG + Intergenic
1046625658 8:116574134-116574156 ACTAAAAATACAAACATTAATGG + Intergenic
1046653606 8:116869078-116869100 ATCAAAAACACAACCCATGAAGG + Intronic
1046664703 8:116988000-116988022 ATAATAAATAAAAGCATTAAGGG - Intronic
1046886319 8:119371191-119371213 GTAGAAAATAGAACCATAGAAGG - Intergenic
1047278496 8:123424540-123424562 ATTAAAAATACAAAAATTAATGG - Intronic
1047575297 8:126147023-126147045 ATAAAATATGCAAGCATTGGTGG + Intergenic
1047579131 8:126193326-126193348 ATAAATAATACAAGGATGGAAGG + Intergenic
1047596062 8:126378957-126378979 ATAAAAAATAAAAAAATTGAAGG + Intergenic
1047693329 8:127378788-127378810 AAAAAAATTACAACCAAGGAGGG + Intergenic
1048157829 8:131977744-131977766 ATTAAAAATACAACCACACAAGG - Intronic
1048338349 8:133519785-133519807 AAAAAAAATACAAACATTAGCGG + Intronic
1048629792 8:136229855-136229877 ATATAAAATGCCATCATTGAAGG - Intergenic
1048912755 8:139151803-139151825 ATAACAAATGGAACCATTGCTGG - Intergenic
1050035579 9:1432530-1432552 AAAAGAAATAAAACCATTGAAGG - Intergenic
1050436322 9:5614472-5614494 AAAAAAAAAAAAAGCATTGAGGG - Intergenic
1050777496 9:9284370-9284392 ATAAAACTTACAACCATGGCAGG - Intronic
1051460851 9:17313140-17313162 ATGCAAAATATAACCATTAAAGG - Intronic
1052046210 9:23797263-23797285 CAAAAAAATACAACCAGTAAAGG + Intronic
1052182167 9:25543230-25543252 ATATAAAGTCCAACCATTGTTGG - Intergenic
1052254274 9:26435696-26435718 TTTAAAAATAAAACCATTAATGG + Intergenic
1052287829 9:26806771-26806793 AAAAAAAATGCCACTATTGATGG + Intergenic
1052314554 9:27103038-27103060 ATAAAAAAGACAAATATTGCAGG + Intergenic
1052921502 9:33974342-33974364 ACAAAAAATACAAATATTAATGG + Intronic
1052966790 9:34346505-34346527 AAAAAAAATACAACTTATGAGGG - Intergenic
1053378174 9:37626028-37626050 ATTAAAAATACAAACATGGCTGG + Intronic
1053712550 9:40834341-40834363 ATAAAAAATAGAAGCATTCTCGG + Intergenic
1055111916 9:72568062-72568084 AAAAAAAAAAAAATCATTGAGGG - Intronic
1055228788 9:74034845-74034867 ATAAAAAAAACAAAAACTGAGGG - Intergenic
1057113255 9:92494742-92494764 ATTAAAAATACAAACATTAGCGG + Intronic
1057565368 9:96161849-96161871 ATCACAAAAAGAACCATTGAAGG - Intergenic
1057724772 9:97560707-97560729 ATAAAAAATACAAAAATTACAGG + Intronic
1057823880 9:98357483-98357505 ACAAAAAATACAAAAATTAATGG + Intronic
1058331058 9:103761032-103761054 GTAAAAAATGCAACCATTTCTGG + Intergenic
1058412776 9:104751611-104751633 AGAAATAATTCAACCATTTAAGG + Intronic
1058737380 9:107906286-107906308 ATCAAAAATGCAAGCAGTGAAGG - Intergenic
1059292907 9:113243376-113243398 ATGAATTATACAGCCATTGAAGG - Intronic
1059310294 9:113384165-113384187 ATTAAAAATAAAACTAGTGAAGG - Intergenic
1059894008 9:118838840-118838862 ATAACAAATAGAACCAGGGAAGG + Intergenic
1060467755 9:123922429-123922451 TTAAAAAATACAAACTTTGAAGG + Intronic
1060790061 9:126480000-126480022 AGAAAAAATATGACCACTGAAGG + Intronic
1060802221 9:126551945-126551967 ATAAAAATTGCAGCCATTTATGG - Intergenic
1060887430 9:127164971-127164993 AACAAAAACACAACCATAGAGGG - Intronic
1060983380 9:127806518-127806540 ATAAAAACTACAATCATTTTTGG + Intronic
1061344640 9:130013133-130013155 ATAAAAAATAGAACAATTGAAGG - Intronic
1061460140 9:130730892-130730914 ATAATAAATACACCCAACGAAGG - Intronic
1062351255 9:136140279-136140301 ATAAACAATAGATCTATTGAGGG + Intergenic
1202802898 9_KI270720v1_random:17843-17865 ATAAATGTTAAAACCATTGAAGG + Intergenic
1186043307 X:5505318-5505340 ATAAAAAATACAACATTAGCCGG - Intergenic
1186284536 X:8029301-8029323 ATAAAGAAAATATCCATTGATGG - Intergenic
1186684633 X:11912664-11912686 TAAAAAAATACAAGTATTGAAGG - Intergenic
1186830532 X:13385649-13385671 AAAAAATAAACAACCATTTAAGG - Intergenic
1187021303 X:15385376-15385398 ATAAAAAAGATCACCATTGCTGG - Intronic
1187399676 X:18948309-18948331 ATTAAAAATACAAACATTAGCGG + Intronic
1187671320 X:21668650-21668672 ATAAAACAGACAACAAGTGATGG - Intergenic
1187803462 X:23091475-23091497 ATTAAAAATCCAACTATTGCCGG + Intergenic
1187882043 X:23856541-23856563 AAAAAAAAATCTACCATTGATGG - Intronic
1188203695 X:27324906-27324928 ACAAAAAAGACAACCATGGAAGG + Intergenic
1189531274 X:41885837-41885859 AGAAGAAATACCACCATTCATGG + Intronic
1189964846 X:46361962-46361984 ACAAAAAATACAAAAATTGCTGG - Intergenic
1190955005 X:55184309-55184331 AGAAAAAGTACATCAATTGAGGG + Intronic
1191199473 X:57763754-57763776 ATAAAAAAGACACACATTTAGGG + Intergenic
1192088612 X:68128209-68128231 ATTAAAAATACAAAAATTGCTGG - Intronic
1192772328 X:74205855-74205877 AAAAAAGAAACAACCATTTAAGG - Intergenic
1193045090 X:77045162-77045184 AGAAAAAATACAACCTATCAAGG + Intergenic
1193057562 X:77169415-77169437 ATAAAAAATGCATCCATTTAAGG - Intergenic
1193202062 X:78703176-78703198 ATAAAAAACACAAGCAAAGATGG - Intergenic
1193328782 X:80213836-80213858 ATATAAGATATTACCATTGAGGG + Intergenic
1193391506 X:80934727-80934749 ATAAAAAATAAAAACGTTAATGG - Intergenic
1193437970 X:81502479-81502501 AAAAAAGATACAAGCAGTGAAGG - Intergenic
1193762760 X:85488447-85488469 AAAAAAAATCCAACCATTCAAGG - Intergenic
1193830634 X:86285352-86285374 ATACAACATACAAAAATTGATGG - Intronic
1193998093 X:88391457-88391479 ATAAATAAAACAGACATTGATGG + Intergenic
1194742069 X:97585585-97585607 AAAAAAAAAAAAACTATTGAGGG + Intronic
1194788554 X:98117689-98117711 TTAAAAACTACAAGAATTGATGG + Intergenic
1195448579 X:104982248-104982270 ATAAAAAATAAAATCCTTCAAGG + Intronic
1196092289 X:111758168-111758190 AAGAAAAATACAACTATTCAAGG - Intronic
1196147717 X:112337634-112337656 ATAAGAAATAAGAGCATTGAAGG - Intergenic
1196586536 X:117435736-117435758 AGAAAAAAAAAAGCCATTGAAGG - Intergenic
1196605835 X:117656008-117656030 ACTAAAAATACAAAAATTGACGG - Intergenic
1197205093 X:123782932-123782954 ATAAAAAATAAAAAAATTAAAGG + Intergenic
1197258868 X:124294520-124294542 AGAAAACATACAATCATGGAGGG - Intronic
1197333660 X:125184868-125184890 ATAAAAATTAAAACCAATGAGGG + Intergenic
1198748750 X:139917993-139918015 ATAAAAAATATAGCAATTGTTGG + Intronic
1199048198 X:143202845-143202867 ATGAATAATACAACAATTAAGGG - Intergenic
1199110479 X:143928066-143928088 TTTAATAATACAAACATTGATGG - Intergenic
1199123433 X:144085816-144085838 ATAAACAATACAAATATGGAGGG - Intergenic
1199349464 X:146783897-146783919 ATAAAAAAAAAAAACATAGAAGG - Intergenic
1199795819 X:151195287-151195309 ATAAAAAAGACAAATATTTAAGG - Intergenic
1200282085 X:154785625-154785647 GTAAAGATTACAACCATTGTGGG - Intronic
1201315915 Y:12644956-12644978 AAAAAAAATACAAGAAGTGAAGG + Intergenic
1201542750 Y:15125941-15125963 AAAAAACAAACAACCATTGCAGG - Intergenic
1201558364 Y:15288684-15288706 ATAAAATATAAAACCAAGGAAGG + Intergenic