ID: 1086596405

View in Genome Browser
Species Human (GRCh38)
Location 11:88576921-88576943
Sequence ATGAGTCTGACTAAAACTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 155
Summary {0: 1, 1: 0, 2: 3, 3: 10, 4: 141}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086596405 Original CRISPR ATGAGTCTGACTAAAACTGC AGG (reversed) Intronic
902134468 1:14292876-14292898 AAGATTCTTAGTAAAACTGCAGG + Intergenic
904536648 1:31203958-31203980 ATGAGTCTGCCTGAGACTGTGGG + Intronic
907021172 1:51068019-51068041 ATGAGTCTCACTAGATCTGATGG - Intergenic
908284230 1:62576628-62576650 ATGATTTTGAATATAACTGCTGG - Intronic
908719544 1:67109606-67109628 ATGAGCATGAATCAAACTGCTGG + Intronic
912121817 1:106480392-106480414 ATGAGTCCGACAAGATCTGCTGG + Intergenic
920715771 1:208338618-208338640 ATGAGTGTGACTAAAAGAGATGG + Intergenic
921449246 1:215284696-215284718 ATCATTCTGACTAAAATTGCTGG + Intergenic
921809787 1:219499539-219499561 ATAAATGTGAATAAAACTGCTGG - Intergenic
1063582595 10:7322182-7322204 ATGAGTCTCACTAAATCTGATGG + Intronic
1063833217 10:9980836-9980858 ATGATTATGAATAAAGCTGCTGG - Intergenic
1064645928 10:17459545-17459567 AAGAGTATAACTAAAACTACGGG + Intergenic
1067006959 10:42673325-42673347 AGGAGTCTGACTATTACAGCAGG + Intergenic
1071162874 10:82771459-82771481 ATGAGCCTGACTATAACTGTGGG - Intronic
1073380044 10:103071399-103071421 AAGAGCCTGACTCAAACCGCTGG - Intronic
1086394056 11:86395992-86396014 AAGAGTTTTACTAATACTGCAGG - Intronic
1086596405 11:88576921-88576943 ATGAGTCTGACTAAAACTGCAGG - Intronic
1087156465 11:94909657-94909679 ATGAGTCAGGCTAAAACTGTGGG + Intergenic
1089021475 11:115219750-115219772 ATTAGGCTAACTACAACTGCTGG + Intronic
1089821758 11:121234770-121234792 ATGAGGCAGAGGAAAACTGCAGG - Intergenic
1090719074 11:129456182-129456204 ATGAGTTTGTATAAAACTGGAGG - Intergenic
1095157181 12:38871597-38871619 ATGGGTCTGAATAAAAAGGCTGG + Intronic
1097076936 12:56402026-56402048 ATAAGTCTGACTAAAATTCAGGG + Intergenic
1097564717 12:61252896-61252918 ATGAATCTGACTAAAATTCAGGG - Intergenic
1103335511 12:120186490-120186512 ATAAGTCTGTCTTACACTGCAGG - Intronic
1106126485 13:26903895-26903917 ATGAGTCTCACGAAACCTGTTGG + Intergenic
1106709819 13:32318170-32318192 ATGATGCTGGGTAAAACTGCTGG - Intronic
1108046344 13:46387721-46387743 ATGAGTCGGACTCAGACTCCAGG - Intronic
1109129354 13:58561836-58561858 ATGATTCTGATAAAAACTGATGG - Intergenic
1111005320 13:82240173-82240195 ATGAGAGTGAAAAAAACTGCTGG + Intergenic
1111709506 13:91793813-91793835 ATGAGTCTCACAAAATCTGATGG - Intronic
1115786515 14:36832455-36832477 ACGGGCCTGACTAAAACAGCAGG + Intronic
1116481914 14:45401315-45401337 AGGAGTCCTGCTAAAACTGCAGG - Intergenic
1116972769 14:51084104-51084126 AAGACTCTTACTAAAACTGTTGG - Intronic
1118108255 14:62686068-62686090 ATTACACTGACTAAAACTGTTGG - Intergenic
1119707450 14:76792877-76792899 ATTACTCTGACTAAAACTTTTGG - Intronic
1120446268 14:84600049-84600071 ATGAGTCTCACAAAATCTGATGG + Intergenic
1120606817 14:86589496-86589518 ATGATTCTGAATAAAATTCCAGG - Intergenic
1124461754 15:29898215-29898237 ATGAGTCTCACAAGAACTGATGG + Intronic
1126583863 15:50264252-50264274 AAGAATCTGATTAAAACTGTAGG + Intronic
1129004267 15:72359035-72359057 ATGAGTCTGGCTGGAACAGCAGG + Intronic
1130375443 15:83324959-83324981 ATGAGTCTGCCTAAGGCTGTGGG + Intergenic
1131992744 15:98106373-98106395 ATGTGTCTAACTAAAAATGAAGG - Intergenic
1132098185 15:99004100-99004122 ATGTGTCTAACTAAAAATGAAGG + Intronic
1135205489 16:20480471-20480493 ATGAGTCTTATTAAAACTGCAGG - Intronic
1135213418 16:20543342-20543364 ATGAGTCTTATTAAAACTGCAGG + Intronic
1136708128 16:32207536-32207558 TTGAGTCTGACTCAAACATCTGG + Intergenic
1136759780 16:32721874-32721896 TTGAGTCTGACTCAAACATCTGG - Intergenic
1136808324 16:33148512-33148534 TTGAGTCTGACTCAAACATCTGG + Intergenic
1141758150 16:86008490-86008512 GTGAGACTGAATAAAAATGCAGG - Intergenic
1203061934 16_KI270728v1_random:982181-982203 TTGAGTCTGACTCAAACATCTGG - Intergenic
1142752015 17:1994604-1994626 ATGAGTCTGAGTGAAGATGCTGG + Intronic
1144017311 17:11208390-11208412 ATGAGTCTCACAAGATCTGCTGG - Intergenic
1148274479 17:46291369-46291391 GTGAGCAGGACTAAAACTGCAGG + Intronic
1148958317 17:51371983-51372005 AAGCGTCTGACTATGACTGCCGG - Intergenic
1150408576 17:64923186-64923208 GTGAGCAGGACTAAAACTGCAGG - Intergenic
1150760211 17:67954589-67954611 GTGAGCAGGACTAAAACTGCAGG - Intronic
1153610696 18:6881346-6881368 GGGAGACTGACTATAACTGCTGG + Intronic
1154509042 18:15075408-15075430 ATGAGTCTCACAAAATCTGATGG + Intergenic
1157341140 18:46779620-46779642 ATGAATCTGACTAAAATTCAGGG + Intergenic
1158036124 18:53032833-53032855 GTTAGTCTGACTTGAACTGCAGG - Intronic
1159111456 18:64061422-64061444 ATGATTCTGACTACCATTGCGGG - Intergenic
1159739912 18:72154694-72154716 ATGAGTCTTACCAAAACTGGTGG - Intergenic
1162849873 19:13422702-13422724 ATGTGACTGACTTTAACTGCTGG - Intronic
1164117393 19:22235575-22235597 ATAAGTCTGACTAAAATTTAGGG - Intergenic
929400363 2:41573197-41573219 ATGAGTCTGAGTAAAATAACTGG + Intergenic
935518125 2:104068924-104068946 ATAAGTCTGACAAGATCTGCTGG - Intergenic
940467631 2:154052010-154052032 AGGAGTATGAGTATAACTGCAGG - Intronic
941465984 2:165827906-165827928 ATGATTCCTCCTAAAACTGCTGG - Intergenic
942255610 2:174094163-174094185 CTGAGACTGGCTGAAACTGCAGG + Intronic
945071135 2:205990101-205990123 ATGAGGTTGACTGAAACTTCAGG + Intergenic
945631466 2:212283217-212283239 ATCAGTATGACTTGAACTGCTGG + Intronic
946015617 2:216601880-216601902 GTGAGTCTGACTCAACCTGTAGG - Intergenic
946799877 2:223402840-223402862 ATTAGTCTGAGTAATTCTGCTGG + Intergenic
947431819 2:230035900-230035922 TTGAGTATAACTGAAACTGCTGG + Exonic
948191810 2:236065054-236065076 ATCAGCCTGACTGATACTGCTGG + Intronic
1169023319 20:2347012-2347034 CTGAGGCATACTAAAACTGCAGG - Intergenic
1169884687 20:10385732-10385754 CTGAGTTTTATTAAAACTGCTGG + Intergenic
1170479735 20:16754069-16754091 AAGGTTCTGACTATAACTGCAGG + Intronic
1172973351 20:38889053-38889075 ATGATTTTTACTAAAACTGTGGG - Intronic
1174659766 20:52201568-52201590 ATGATCCAGACTAAACCTGCTGG + Intronic
1176789031 21:13296376-13296398 ATGAGTCTCACAAAATCTGATGG - Intergenic
1177099884 21:16887307-16887329 ATGAGTCCAAATAAACCTGCTGG - Intergenic
1177575244 21:22946145-22946167 AAGAGTGTGAATGAAACTGCAGG + Intergenic
1177933765 21:27317401-27317423 ATAAATCCGACTAAAACTGAAGG - Intergenic
1177988192 21:28004546-28004568 ATGAGTCTCACAAAATCTGATGG - Intergenic
1178011211 21:28289314-28289336 ATAAGTCTCACAAAATCTGCTGG - Intergenic
1179270584 21:39847705-39847727 GTCAGTCTGACTCACACTGCAGG - Intergenic
1180701835 22:17785421-17785443 ACGAGACTGACTGAAGCTGCTGG - Intergenic
956249001 3:67215893-67215915 ATGTGTCTGTCTGAAACTGCTGG - Intergenic
957108870 3:75927041-75927063 TTGAGTGTGAATAAAACTTCAGG + Intronic
957488957 3:80898482-80898504 ATGCATCTGATTAAGACTGCTGG - Intergenic
959729682 3:109586780-109586802 AAGAGACTGTCTAAAAGTGCTGG + Intergenic
964756078 3:160091923-160091945 ATGACTTTGCCTAAAAATGCTGG + Intergenic
966878046 3:184334889-184334911 AGGAGTCTGACCACAACTGAGGG + Exonic
974213716 4:58817184-58817206 AAGAGTCTTACTAAGACTGTTGG + Intergenic
974705525 4:65510600-65510622 ATGTGTGTGAGTATAACTGCTGG + Intronic
975365848 4:73526802-73526824 AGGAGTCTGACTAAAACTCCTGG + Intergenic
977164105 4:93673973-93673995 ATGAGTCTGAAAAAAAAAGCAGG - Intronic
979243304 4:118469408-118469430 ATATGTCTGTCTAAAATTGCTGG + Intergenic
979900767 4:126215073-126215095 ATGAGTCTCTCTATAAATGCAGG + Intergenic
980388000 4:132111651-132111673 ATGAATCTGACTAAAATTCAGGG - Intergenic
982387333 4:154824194-154824216 ATGGGTATGATTAAAATTGCTGG + Intronic
982536816 4:156617208-156617230 ATGAGCCTAAGTAAAACTGGCGG + Intergenic
984848267 4:184126777-184126799 ATGAATCTAACTAAATCTTCAGG + Intronic
986424667 5:7618989-7619011 AAGAGGCTTACTAAAAATGCTGG - Intronic
986520222 5:8607787-8607809 GTGAGTGTGACTAGAACTGCAGG + Intergenic
989262911 5:39438434-39438456 ATGAGTCTCACTAGATCTGATGG + Intronic
989476339 5:41878264-41878286 AGGAGTTTGACTAGAACTCCTGG - Intergenic
989561271 5:42854505-42854527 ATGAGTGTGACTTCAACTGTAGG + Intronic
990788851 5:59454373-59454395 ATGAGTCTTACAAAATCTGATGG + Intronic
995572552 5:113495617-113495639 ATCAGTCTGAGTTAAACTGAAGG + Intergenic
999351323 5:150874379-150874401 ATGAATCTGACTAAAATTCAGGG + Intronic
999930245 5:156424542-156424564 ATTACTCTGAATGAAACTGCAGG - Intronic
1000208549 5:159087571-159087593 ATTAGTTTCACTAAGACTGCTGG + Intronic
1001175783 5:169467792-169467814 AAGAGTATGCCTAATACTGCAGG + Intergenic
1002114675 5:176949960-176949982 ATGAGAATCACTAAAACTCCGGG + Intronic
1004933106 6:20480792-20480814 ATGAGTCTCACTAGCACTGCAGG - Intronic
1005696015 6:28353514-28353536 ATGACTCTGACGAAACCTGATGG + Intronic
1008255925 6:49299428-49299450 ATCAGACTGACTAATACTGTTGG + Intergenic
1010104892 6:72155689-72155711 ATGAGTCTCACTAGATCTGATGG - Intronic
1010407037 6:75517290-75517312 ATAAGTCTGACTAAAATTCAGGG - Intergenic
1018549623 6:164980757-164980779 ATAAGTCTCACTAAACCTGATGG + Intergenic
1022485595 7:30775183-30775205 ATGAGCGTGACTTAACCTGCAGG - Intronic
1023250738 7:38258058-38258080 GTAATTCTGACTAAAATTGCTGG - Intergenic
1024386067 7:48753472-48753494 AACAGTCTGACAGAAACTGCAGG + Intergenic
1026128915 7:67604469-67604491 ATGCCTCTGAATAGAACTGCTGG + Intergenic
1028041793 7:86062770-86062792 ATGGGTCTCACGAGAACTGCTGG + Intergenic
1028189298 7:87826262-87826284 ATGAGTCTCACGAAATCTGATGG + Intronic
1030457532 7:109793521-109793543 ATGAATCTGACTAAAATTCAGGG - Intergenic
1032682661 7:134201555-134201577 AAGAGTTTGGCTACAACTGCAGG + Exonic
1034778153 7:153850746-153850768 ATAAGTCTCACTAAATCTGATGG - Intergenic
1037416777 8:18659803-18659825 ATGAGAATGGCTAAAACTGGAGG + Intronic
1038280261 8:26158079-26158101 ATGAGTCTCACGAGAACTGATGG - Intergenic
1041151239 8:54936929-54936951 ATGAGTCAGAAAAAAATTGCTGG - Intergenic
1042888953 8:73585891-73585913 ATGAGTCTGACAAGATCTGATGG + Intronic
1043659593 8:82721166-82721188 ATGAGTCTGATTCAAACTGGTGG + Intergenic
1043973184 8:86555918-86555940 TTGACTCTTACAAAAACTGCAGG - Intronic
1044278115 8:90325511-90325533 ATGATGCTGAGTAAAACTCCTGG + Intergenic
1044326394 8:90863962-90863984 ATTAGTGTGACTCAAAGTGCGGG + Intronic
1045787831 8:105943263-105943285 TTGAATCTCACTTAAACTGCAGG + Intergenic
1047577561 8:126174474-126174496 ATAAGTCTCACGAAAACTGATGG + Intergenic
1048083915 8:131157312-131157334 ATGAATCTGACTAAAATTCAGGG - Intergenic
1048222071 8:132551341-132551363 ATGAGTCTCACGAAACCTGATGG - Intergenic
1049962049 9:746386-746408 TTGACTCTGAGTACAACTGCTGG + Intergenic
1051054332 9:12966026-12966048 ATTAGAATGACTAAAACTGAAGG + Intergenic
1051268578 9:15332643-15332665 ATGTGTCTGGCTAAAACTTTTGG - Intergenic
1052553930 9:29988252-29988274 ATGAGCCAGACTGAAGCTGCAGG - Intergenic
1056058045 9:82849629-82849651 TTAAGTCTGACTAAAACTTTTGG + Intergenic
1058017044 9:100045287-100045309 ATGAGTCTGACTTAGTCTGCAGG - Intronic
1193832883 X:86309630-86309652 ATAAATCTGACTAAAATTGAGGG + Intronic
1194054554 X:89116124-89116146 ATGAGTGTGAATAAAACTAGAGG - Intergenic
1196587923 X:117451413-117451435 ATGAGTTTGACTTAAACTTGAGG + Intergenic
1197005268 X:121488941-121488963 TTGAGTCTGAGGAAATCTGCAGG + Intergenic
1198888322 X:141363272-141363294 ATGAGTCTCACAAAATCTGATGG - Intergenic