ID: 1086596593

View in Genome Browser
Species Human (GRCh38)
Location 11:88579463-88579485
Sequence GAGGTAGAACTGGATATGAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 218
Summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 191}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086596593 Original CRISPR GAGGTAGAACTGGATATGAG GGG Intronic
904430267 1:30459811-30459833 TAGGGAGAACTGGAGATGACTGG + Intergenic
904792185 1:33031227-33031249 GAGGCAGAAATGAATATGAATGG - Intronic
907520391 1:55019876-55019898 GAGGAAGGACGGGATCTGAGTGG - Intergenic
910893511 1:92042869-92042891 GTTGTAGCACTGGATTTGAGAGG + Exonic
911382053 1:97127496-97127518 GAGGTGGAATGGGATACGAGGGG - Intronic
912414455 1:109498531-109498553 GAGGGAGAAATGGAAAAGAGGGG - Intronic
912480035 1:109976188-109976210 GAGGTAGAGCTGGGGGTGAGGGG + Intergenic
913316798 1:117560586-117560608 GAGGTAGAATTGACTAGGAGGGG + Intergenic
914702553 1:150148473-150148495 AAGGTGGAACTGGAAAAGAGAGG + Intergenic
915200512 1:154223853-154223875 GAGATATTACTGGATTTGAGTGG - Intronic
917790280 1:178494941-178494963 GAGGTAGAGCTGGATATGACTGG - Intergenic
924370272 1:243340494-243340516 GAGGGAGAACTAGATAATAGGGG + Intronic
1064704679 10:18059587-18059609 GAGAGAGAACTGGATGTTAGGGG - Intergenic
1065089693 10:22219476-22219498 GAGGTAGAAGTGGATCTGAAAGG - Intergenic
1065275326 10:24079852-24079874 AATTTAGAACTGGATCTGAGAGG + Intronic
1066713006 10:38256240-38256262 GATTTACAACTGGAAATGAGAGG - Intergenic
1072553613 10:96497613-96497635 GAGCTGGAACTGGGTAGGAGGGG - Intronic
1074625292 10:115177303-115177325 GAAGTAGAAGTGGAAATGATGGG + Intronic
1077459585 11:2702118-2702140 GAGGTAGAAATGGACATGCAGGG - Intronic
1081880118 11:46442571-46442593 GAGGTAGAAAGTGAAATGAGAGG + Intronic
1083592597 11:63904323-63904345 GAGGGAGAACTGGAAAAGAGGGG - Intronic
1084314578 11:68337700-68337722 GAGGTAGACCTGACTATGGGTGG - Intronic
1085810642 11:79677948-79677970 CAGGAAGATCTGGATGTGAGGGG - Intergenic
1086596593 11:88579463-88579485 GAGGTAGAACTGGATATGAGGGG + Intronic
1088805862 11:113351509-113351531 GAGGAAAAGCTGGATATGGGTGG + Intronic
1089261343 11:117225906-117225928 GAGGCAGAGCTGCAGATGAGAGG - Intronic
1089669160 11:120040485-120040507 GAGGGAGAAGTCGACATGAGAGG - Intergenic
1089705597 11:120275443-120275465 GAGGTAGAATTGGATTAAAGGGG + Intronic
1090857538 11:130623470-130623492 GAGGGAGGAGTGGATATGAGTGG + Intergenic
1093706899 12:22284360-22284382 GAGGTAGAAATGCAGGTGAGTGG - Intronic
1094666182 12:32523475-32523497 GAACTAGAACTGTATATGGGTGG + Intronic
1097039006 12:56143203-56143225 GGGGTAGGACTGGATGTTAGGGG - Intronic
1098338877 12:69431459-69431481 GAGGTAAGACTGGATTAGAGTGG + Intergenic
1100150527 12:91731255-91731277 GAAGTGGAAAGGGATATGAGTGG - Intergenic
1100494468 12:95111576-95111598 AAAGTAGGACTGGAGATGAGTGG - Intronic
1107889149 13:44898895-44898917 GAGGTAGAAGAGGAGAAGAGAGG - Intergenic
1108266929 13:48720235-48720257 TAGGAAGAATTGGATATGTGTGG - Intergenic
1110232724 13:73183432-73183454 AAGGGAGACCTGGATATGAGTGG - Intergenic
1110680773 13:78309391-78309413 GAGGCAGAGATGGAAATGAGAGG - Intergenic
1111001966 13:82196239-82196261 GAGCTATAACTGGATATTAGAGG + Intergenic
1112429264 13:99336013-99336035 GAGATAAAACTGGATGTTAGAGG + Intronic
1114157601 14:20122744-20122766 AAAGTATAACAGGATATGAGAGG - Intergenic
1115346837 14:32352163-32352185 GAGAGAGAACTGGCTATGATAGG - Intronic
1117827509 14:59718946-59718968 GTGGTAGCATTGGAGATGAGAGG - Intronic
1118911794 14:70067841-70067863 GAAGAAGAACTGGAAATGGGGGG - Intronic
1118996812 14:70844123-70844145 GAGGTAGAAATGAATCTGAAAGG - Intergenic
1119531701 14:75366165-75366187 GAGGGGGAAATGGATATCAGTGG - Intergenic
1119993309 14:79224653-79224675 GAGGTCACACTGGAGATGAGTGG + Intronic
1123149025 14:106163728-106163750 GAGGAAGTACTGGTTATGATTGG + Intergenic
1123673565 15:22685458-22685480 GTTGTAGATCTGCATATGAGAGG + Intergenic
1124325567 15:28758450-28758472 GTTGTAGATCTGCATATGAGAGG + Intergenic
1124997529 15:34738058-34738080 GAGGTACAACTTGGTATGGGAGG - Intergenic
1127777290 15:62274932-62274954 GAGGGAGAATAGGATATGAATGG - Intergenic
1128718904 15:69931215-69931237 GAGGTAGAGCTGGAGGGGAGGGG + Intergenic
1130397693 15:83517885-83517907 GAGGGAGAACTGGAGGTGAGGGG - Intronic
1132336651 15:101052269-101052291 GAGGTAGGAGTGGAAAGGAGAGG - Intronic
1132556852 16:576342-576364 AAGGTAGAACTGGCTTTGTGGGG - Intronic
1134534472 16:15014593-15014615 GAGGTAGATTTAGGTATGAGGGG + Intronic
1135398235 16:22147426-22147448 CAGCTAGAACTGGACAGGAGGGG + Intronic
1136281153 16:29212256-29212278 GAAGCAGAATTGGAGATGAGAGG + Intergenic
1136888285 16:33948476-33948498 GAGGAAGTACTGGTTATGATCGG + Intergenic
1138805534 16:60085250-60085272 CAGCTTGAACTGAATATGAGAGG - Intergenic
1139861575 16:70026182-70026204 GAGGTAGATTTAGGTATGAGGGG - Intergenic
1140050472 16:71476447-71476469 GAGGTGGAACAGGGTATCAGTGG + Intronic
1142085516 16:88178179-88178201 GAAGCAGAATTGGAGATGAGAGG + Intergenic
1203084163 16_KI270728v1_random:1169346-1169368 GAGGAAGTACTGGTTATGATCGG - Intergenic
1143202404 17:5122038-5122060 GAGGGAGAAATGGATCAGAGGGG + Intronic
1144626968 17:16848892-16848914 GAGGGAGAAATGGATCAGAGGGG - Intergenic
1144879471 17:18423820-18423842 GAGGGAGAAATGGATCAGAGGGG + Intergenic
1145152769 17:20520567-20520589 GAGGGAGAAATGGATCAGAGGGG - Intergenic
1146164106 17:30574738-30574760 GAGGGAGAAATGGATCAGAGGGG - Intergenic
1147581104 17:41627577-41627599 GAGGGAGAAATGGATCAGAGGGG - Intergenic
1147664426 17:42137347-42137369 GAGTTATAACTTGATTTGAGAGG + Intronic
1156515565 18:37676519-37676541 GAGGTAGATCCAGATATTAGTGG + Intergenic
1159321550 18:66857215-66857237 GAGGCAGAACTGAATCTGGGAGG + Intergenic
1159634490 18:70788781-70788803 GGGTTAGAACTGGATATCAGTGG - Intergenic
1160761869 19:789546-789568 GAGGCAGAATTTGATCTGAGGGG - Intergenic
1161957899 19:7506500-7506522 GAGTTAAGACTGGATAAGAGAGG - Intronic
1162796800 19:13091283-13091305 GAGGCAGAGCAGGAGATGAGAGG - Intronic
925415053 2:3664140-3664162 GTAGTAGAAAAGGATATGAGTGG + Intronic
928636977 2:33256843-33256865 GATGCAGAACTGGATATGGAGGG + Intronic
929299650 2:40288491-40288513 GAGGTAGAAGTGGAGGGGAGAGG - Intronic
931443911 2:62310836-62310858 GAGGTAGAAATGAATATGATGGG - Intergenic
931553523 2:63473469-63473491 GAGGTAGAACTTAAAATAAGGGG - Intronic
931692268 2:64845403-64845425 GAGAAAGAACTGCATTTGAGTGG - Intergenic
932191785 2:69747114-69747136 GAGGTAGAGGTGGACATGGGGGG - Intronic
932308119 2:70718308-70718330 GAACTAGAACTGGATGTGAGAGG + Intronic
932745305 2:74329225-74329247 GAGGTATAAATGGAGATGTGGGG + Intronic
933259390 2:80115074-80115096 GAGGTAGTACTGGATGTCTGGGG + Intronic
933674499 2:85042409-85042431 GTGGTAGCGCTGGAGATGAGGGG - Intronic
935999118 2:108807907-108807929 AAATTAGAACTGGATAGGAGGGG - Intronic
936491653 2:112977669-112977691 GAGCTAGAACTGGAAATGCCAGG - Intronic
936751001 2:115641457-115641479 GAGGTAGTATTGGAAATGAACGG - Intronic
936822508 2:116540456-116540478 GAGGCAGAATAGGAGATGAGAGG - Intergenic
941158128 2:162003293-162003315 GGGGTAGAGCTGGAGAAGAGGGG + Intronic
942510590 2:176695778-176695800 GAGGTAGAGATGGAAATGAATGG - Intergenic
943509897 2:188811739-188811761 GAAGTAGAACAGGATTTGAGTGG - Intergenic
945913505 2:215677498-215677520 GAGGTAGAGCAGGATAGGAGAGG - Intergenic
945956386 2:216090088-216090110 CAGGATGAACTGGATATGAGTGG + Intronic
946705698 2:222456682-222456704 GGGGTAGAATAGGATCTGAGTGG + Intronic
947091179 2:226512866-226512888 GAGGAAAAAGTGGAAATGAGTGG - Intergenic
948421110 2:237860435-237860457 GAGGGAGAAGTGGAGATTAGCGG + Intronic
948479833 2:238242223-238242245 GATGGGGAACTGGATTTGAGGGG + Intergenic
1168731708 20:88269-88291 GGGGTAGAAGTGGAAATAAGTGG + Intronic
1168815330 20:732868-732890 GAGGTAATACTGGATTAGAGTGG + Intergenic
1169732579 20:8802171-8802193 CAGGTAGGACTGGATGGGAGGGG + Intronic
1170230499 20:14041987-14042009 GAGGAAACACTGGATATTAGAGG + Intronic
1170411412 20:16096250-16096272 GAGGTGGAACTGGATAAAATAGG - Intergenic
1170815110 20:19707324-19707346 GCGGTAAAACTGGAGATCAGTGG + Intronic
1172791821 20:37511115-37511137 GAGGAAGAAGTGGAGATGAGAGG - Intronic
1172883839 20:38218378-38218400 GAGGCAGATTTGGACATGAGGGG + Intronic
1173829450 20:46071631-46071653 GAGGTTGAATTAGAAATGAGAGG - Intronic
1174285376 20:49469038-49469060 GAGGTTGAACTGGATGGGAAAGG + Intronic
1175349413 20:58308322-58308344 GAGGAAGTACTGTATATGACTGG + Intergenic
1175480841 20:59309614-59309636 GAGATAGAAATGGTTATGTGAGG - Intronic
1176942632 21:14942319-14942341 GAGGTAGAACAGGATAAACGTGG + Intergenic
1177708796 21:24743480-24743502 GCTGTAGAACTGGATCTCAGAGG + Intergenic
1178041641 21:28646368-28646390 GAGGGAGAAGAGGATATGAGGGG + Intergenic
1203291598 22_KI270736v1_random:619-641 TGGGTAGAAATGGATATGAATGG + Intergenic
949834263 3:8250916-8250938 GAGGTAGAAATAGAGATGATAGG + Intergenic
952207390 3:31193465-31193487 GAGTTGGAACTGGACATGAAGGG - Intergenic
953529208 3:43724617-43724639 GAGGTAGATCTCTATATAAGTGG + Intronic
953542400 3:43833483-43833505 GAGGAAGAAATGGATAGGAAGGG - Intergenic
954642131 3:52106993-52107015 GAGGAAGAAGTTGATCTGAGAGG + Intronic
955750008 3:62177905-62177927 GTGGGAGAGCTGGATATTAGGGG - Intronic
956722585 3:72131460-72131482 GAGGATGAACTGGCTAGGAGAGG + Intergenic
957382600 3:79452320-79452342 GAGCTGAAAGTGGATATGAGTGG - Intronic
959614981 3:108337017-108337039 GAGGTTGAAGCGGATTTGAGGGG + Intronic
959646171 3:108704526-108704548 GAGGAAGAACTGGATTAGGGAGG + Intergenic
963338556 3:144005425-144005447 CAAGTAGCACTGAATATGAGGGG - Intronic
964533364 3:157692611-157692633 GGGGAAGAACTGGTGATGAGAGG - Intergenic
966140170 3:176748293-176748315 GAGGTAGAGCAGGATAAGTGAGG - Intergenic
966632564 3:182094900-182094922 CAGGGAGAACTGGATGTGAAGGG - Intergenic
970372123 4:15418479-15418501 GAGGGAGAACAGTATGTGAGAGG - Intronic
970749560 4:19341381-19341403 GAGGTAGAAGTGGAAAAAAGAGG - Intergenic
972471840 4:39413099-39413121 GAGGAAGAAATGGACGTGAGAGG - Intronic
975060909 4:69997952-69997974 AAGATAGAACTGGATATTATGGG - Intronic
976544415 4:86318092-86318114 GAGGTCCTACTGGATTTGAGAGG - Intronic
976831562 4:89320678-89320700 GAGGTAGCACTTGATATAAGTGG - Intergenic
978577249 4:110199363-110199385 TAGGTAGAACAGAATATGTGAGG + Intergenic
979468479 4:121069803-121069825 GAGGGACAACTGGGAATGAGGGG - Intronic
980069761 4:128231055-128231077 CTGGTAGGACTGGATATGAAGGG + Intergenic
981971588 4:150668766-150668788 GAAGTAGAAGTTGATGTGAGGGG + Intronic
982132136 4:152239215-152239237 GAGATAGAACTGGATCTGAAGGG - Intergenic
982927300 4:161354254-161354276 GAGTTAGAACTAGATCTGAGGGG - Intergenic
983072215 4:163281518-163281540 TAAGTAGCACTGGATATAAGAGG + Intergenic
986432681 5:7697124-7697146 GAGGTAGAACTGGAATTGGGTGG - Intronic
986859276 5:11906245-11906267 GAGGTGGAAAGGGAGATGAGGGG + Intergenic
987095539 5:14546112-14546134 CAGGCAGATCTGGACATGAGTGG + Intergenic
989808986 5:45649157-45649179 GAAGTAGAAAGGGATTTGAGGGG - Intronic
993763999 5:91832870-91832892 GAAGGAGAATTGGATAGGAGGGG + Intergenic
995654535 5:114410354-114410376 CAGGTAGAACTGGATATTGTGGG + Intronic
996229947 5:121050310-121050332 GAGGTAGAAGTGGAGTTGGGTGG - Intergenic
996317270 5:122174205-122174227 CAGATAGAAGTGGATATGTGGGG - Intronic
998189996 5:140015559-140015581 GAGGTAGGACTGGATCTGTGCGG + Intronic
998957158 5:147450608-147450630 GTGGTAGGGCTGGAAATGAGGGG - Intronic
999126560 5:149250449-149250471 GAGGCAGATTTGGAGATGAGAGG - Exonic
1000269322 5:159668498-159668520 TAGGTAAAGCTGGAAATGAGCGG + Intergenic
1000803435 5:165757976-165757998 CAGATAGAACTGGAGATAAGAGG + Intergenic
1001743326 5:174071173-174071195 GACCAAGAACTGGAAATGAGAGG + Intronic
1001829421 5:174773211-174773233 GAGGCAGAGCTGGAAATTAGGGG + Intergenic
1002667520 5:180836511-180836533 GAGGTCACACTGGATTTGAGGGG - Intergenic
1004515700 6:16320749-16320771 GAGTATGAACTGGATTTGAGGGG - Intronic
1006099748 6:31679293-31679315 GAGGTAGAATGGGGTGTGAGTGG - Intronic
1006376338 6:33673577-33673599 GAGGATGAACTGGAGAAGAGAGG - Exonic
1006455887 6:34131647-34131669 CAGGTAGAAGTGGAGATGAAGGG - Intronic
1007031112 6:38627621-38627643 GAGGTGGAACTGGATGTCTGTGG + Intronic
1007088127 6:39164992-39165014 GAGGCAGAGCTGGAGATGAGGGG + Intergenic
1007196208 6:40062979-40063001 GAGGTAGAACTGAATTTCTGAGG - Intergenic
1007245270 6:40457157-40457179 GAGGTAGAAATGGATAACAATGG + Intronic
1007376270 6:41458873-41458895 GATGCAGATGTGGATATGAGGGG - Intergenic
1008827637 6:55716825-55716847 GAGGTGGAATTGGATCTGGGAGG + Intergenic
1009448030 6:63766525-63766547 GAGGTTGAAGTAGATGTGAGAGG + Intronic
1010085142 6:71908435-71908457 GAGGGAGACCTGGAGAGGAGTGG + Intronic
1010623590 6:78107331-78107353 GAGGATGAAATGGATATGAATGG - Intergenic
1011896461 6:92232963-92232985 GAGGTAACACTGCATATCAGTGG + Intergenic
1012316424 6:97786551-97786573 GAGGAAGAAATGAATAGGAGAGG - Intergenic
1012534257 6:100276924-100276946 TAGTTAGTAATGGATATGAGAGG - Intergenic
1014462768 6:121717483-121717505 GAGAAAAGACTGGATATGAGAGG - Intergenic
1016259511 6:142150975-142150997 GAGGTAGAACTTTGTATAAGGGG + Intronic
1018184554 6:161255154-161255176 GAAGGAGAACTGGATGTGTGAGG - Intronic
1018707127 6:166471153-166471175 GAGTGAGAGCTGGACATGAGGGG - Intronic
1019208556 6:170384520-170384542 CAGGTAGAAATGGCCATGAGAGG + Intronic
1020764116 7:12299709-12299731 GTGGTAAAGCAGGATATGAGAGG + Intergenic
1020907556 7:14083083-14083105 GAGGTAGAAATGTGTGTGAGTGG + Intergenic
1023234475 7:38069403-38069425 GCGCTAGAACTGCATATGAGTGG - Intergenic
1024305412 7:47924931-47924953 GAGGTCAAATTGGAAATGAGAGG + Intronic
1026600034 7:71770255-71770277 AAGGAAGAAGTGGATAAGAGAGG + Intergenic
1030848064 7:114447153-114447175 GAGGTAGAATTGAAAATGATTGG - Intronic
1032087913 7:128893355-128893377 GAGGCAGATCTGGGTGTGAGCGG + Intronic
1033069109 7:138185778-138185800 GAGGTTGTACTGGAGAAGAGTGG - Intergenic
1034139278 7:148801427-148801449 GAGGTAGGACTGAAGGTGAGTGG + Intergenic
1037606680 8:20443807-20443829 GAGGTGGAACAGGATATTAGAGG + Intergenic
1039695435 8:39905547-39905569 GAGGAAGAGCTGGATGTGGGAGG - Intronic
1046626322 8:116580203-116580225 GAGGTATAACTGTATTTAAGGGG - Intergenic
1047053762 8:121141620-121141642 GAGGTGGAACTGGCAGTGAGCGG + Intergenic
1047634913 8:126750942-126750964 GAGGTAGGAGTGGAAATGGGAGG + Intergenic
1048003924 8:130402852-130402874 GAGGGAGAAATGGTGATGAGGGG - Intronic
1051748275 9:20316371-20316393 GAGGGAGAGCTGGATGTAAGAGG + Intergenic
1055195584 9:73588993-73589015 GACCTAAAACTAGATATGAGGGG - Intergenic
1055261095 9:74434683-74434705 CAGGTTGAACTGGAGATGGGTGG - Intergenic
1055419223 9:76119911-76119933 GAGGTAGAAATGGTTAGGAGAGG - Intronic
1055858351 9:80718901-80718923 GAAGTAGTACTGGATTAGAGTGG - Intergenic
1058456643 9:105143739-105143761 GAGTTGGAACAGGACATGAGAGG - Intergenic
1059402545 9:114079301-114079323 GAGGTTGAACTGGATGACAGGGG + Intergenic
1059580580 9:115543729-115543751 GAGAAGGAACTGGATATGATTGG - Intergenic
1059605425 9:115829639-115829661 GTGGTAGAACTGGGTGTGAGAGG + Intergenic
1186328782 X:8510019-8510041 TAGGTAGAAATAAATATGAGTGG - Intergenic
1187520500 X:20009591-20009613 GAGGTAGAAGTGGCTGTGAGTGG + Intronic
1188756383 X:33968891-33968913 GAGGTAGAGCTGGGCCTGAGAGG + Intergenic
1188930754 X:36108301-36108323 GAGGTAGATTTGGATCTGGGAGG - Intronic
1190260350 X:48793359-48793381 GAGGTAGAACAGGAACAGAGTGG - Intronic
1192736102 X:73850858-73850880 GAGGCAGCACTGGACAGGAGGGG + Intergenic
1194775333 X:97956033-97956055 GAAGTAGATATGGAAATGAGGGG + Intergenic
1195956662 X:110338428-110338450 CAAGTAGAACTGGAAATGAAGGG - Intronic
1198223905 X:134627896-134627918 AAGGGAGACCTGGATTTGAGGGG + Intronic
1199885395 X:152016305-152016327 GAGATAGAACTAGATTAGAGAGG - Intergenic
1200384046 X:155870788-155870810 AAGGTAGAAATGTATACGAGAGG - Intergenic