ID: 1086600172

View in Genome Browser
Species Human (GRCh38)
Location 11:88623824-88623846
Sequence AGTAGCTAGAAGACCAAGTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 183
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 164}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1086600172_1086600174 -8 Left 1086600172 11:88623824-88623846 CCAAACTTGGTCTTCTAGCTACT 0: 1
1: 0
2: 0
3: 18
4: 164
Right 1086600174 11:88623839-88623861 TAGCTACTAGTACATCCAGGTGG 0: 1
1: 0
2: 0
3: 4
4: 53
1086600172_1086600178 -2 Left 1086600172 11:88623824-88623846 CCAAACTTGGTCTTCTAGCTACT 0: 1
1: 0
2: 0
3: 18
4: 164
Right 1086600178 11:88623845-88623867 CTAGTACATCCAGGTGGTGGGGG 0: 1
1: 0
2: 0
3: 19
4: 116
1086600172_1086600175 -5 Left 1086600172 11:88623824-88623846 CCAAACTTGGTCTTCTAGCTACT 0: 1
1: 0
2: 0
3: 18
4: 164
Right 1086600175 11:88623842-88623864 CTACTAGTACATCCAGGTGGTGG 0: 1
1: 0
2: 0
3: 10
4: 50
1086600172_1086600179 1 Left 1086600172 11:88623824-88623846 CCAAACTTGGTCTTCTAGCTACT 0: 1
1: 0
2: 0
3: 18
4: 164
Right 1086600179 11:88623848-88623870 GTACATCCAGGTGGTGGGGGTGG 0: 1
1: 0
2: 0
3: 33
4: 341
1086600172_1086600180 2 Left 1086600172 11:88623824-88623846 CCAAACTTGGTCTTCTAGCTACT 0: 1
1: 0
2: 0
3: 18
4: 164
Right 1086600180 11:88623849-88623871 TACATCCAGGTGGTGGGGGTGGG 0: 1
1: 0
2: 1
3: 27
4: 314
1086600172_1086600176 -4 Left 1086600172 11:88623824-88623846 CCAAACTTGGTCTTCTAGCTACT 0: 1
1: 0
2: 0
3: 18
4: 164
Right 1086600176 11:88623843-88623865 TACTAGTACATCCAGGTGGTGGG 0: 1
1: 0
2: 0
3: 4
4: 68
1086600172_1086600177 -3 Left 1086600172 11:88623824-88623846 CCAAACTTGGTCTTCTAGCTACT 0: 1
1: 0
2: 0
3: 18
4: 164
Right 1086600177 11:88623844-88623866 ACTAGTACATCCAGGTGGTGGGG 0: 1
1: 0
2: 1
3: 7
4: 90

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086600172 Original CRISPR AGTAGCTAGAAGACCAAGTT TGG (reversed) Intronic
904895696 1:33816166-33816188 GGTGGCTAGAATACCAAGCTTGG - Intronic
905989155 1:42318158-42318180 TGCAGTTAGAAGACCAAGTTAGG + Intronic
906001216 1:42427318-42427340 AGTAGCTGGGAGATCAAGATCGG + Intergenic
906617592 1:47244664-47244686 AGTAGATAGAACACCAAATTAGG - Intergenic
906851191 1:49251739-49251761 AGCAGCTAGAAAACAAAGTTGGG + Intronic
908304680 1:62800251-62800273 TGGATCTAGAAGACCAAGCTTGG + Intronic
909006327 1:70280570-70280592 AGTAGCTAAAACACCAACTGTGG + Intronic
909708857 1:78620725-78620747 AATAGCTAGAAGAGAAAATTTGG - Intronic
918432856 1:184480332-184480354 ATTGGCTAGAAAACTAAGTTAGG + Intronic
918557644 1:185822446-185822468 AGGAGCTAGAACACTCAGTTTGG - Intronic
919270120 1:195330694-195330716 AGAAGCTCGAAGAGCAAGTTTGG - Intergenic
921045334 1:211472866-211472888 AGTAGCCATGTGACCAAGTTTGG - Intergenic
924223563 1:241902636-241902658 AGCAGCTGGAAGAACGAGTTAGG + Intergenic
924375648 1:243405165-243405187 ACTAGCAAGAAGTCTAAGTTTGG - Intronic
1063604034 10:7507463-7507485 AGTAGATAGAAGATGAAGTTGGG + Intergenic
1063871642 10:10423421-10423443 AGTAGCTGGGAGGCCAAGGTGGG - Intergenic
1066443865 10:35464159-35464181 GGGAGCTGGAAGACCCAGTTCGG - Intronic
1067385530 10:45814874-45814896 AGTAGCTAGAAGGCTAAGTGTGG + Intergenic
1068285523 10:54929253-54929275 AGTAGGCAGATGACAAAGTTGGG - Intronic
1074738156 10:116457438-116457460 AATACCTAGAAGTCCAAATTGGG + Intronic
1076851368 10:133095072-133095094 AGTAGCCAGAACACCAAGGAGGG + Intronic
1078124425 11:8546449-8546471 AATAGCTAGAAGACAAAATTTGG - Intronic
1079499472 11:21086475-21086497 AGTAGCTAAAAGATAAAATTTGG + Intronic
1080589260 11:33707407-33707429 AGTACATTCAAGACCAAGTTTGG + Intronic
1080694268 11:34587518-34587540 AGAAGCTAGAAGATCAAATCTGG - Intergenic
1081598370 11:44475029-44475051 AGCAGGTAGAAGACCATGTCTGG + Intergenic
1082104039 11:48200433-48200455 AGTAGCCAGAAAAACAATTTTGG + Intergenic
1082280596 11:50267671-50267693 AATAGCTAGAAGAGAAAATTTGG + Intergenic
1086600172 11:88623824-88623846 AGTAGCTAGAAGACCAAGTTTGG - Intronic
1087364428 11:97201291-97201313 AATAGCTAGAACACTAAGTCAGG - Intergenic
1087619965 11:100529353-100529375 AGGAGCCAGAGGACAAAGTTGGG + Intergenic
1088644887 11:111910169-111910191 AATGTCTAGAAGACTAAGTTAGG - Intronic
1089821431 11:121230794-121230816 AGTAACTAGATTACCATGTTAGG + Intergenic
1090064983 11:123494998-123495020 AATACCTAGAAGAGCAAGTTAGG - Intergenic
1090162417 11:124509909-124509931 AGGAGCCAGAAAACAAAGTTGGG - Intergenic
1090978092 11:131693038-131693060 AGTCATTAGAAGGCCAAGTTGGG + Intronic
1094333353 12:29320642-29320664 TGTAGCTAAAAGACCTAGGTTGG + Intronic
1094835385 12:34319748-34319770 AGTAGCAAGAAGACCCAGAATGG - Intergenic
1097249717 12:57625836-57625858 AGTAGATTGAAGACCAAATCAGG + Exonic
1097276421 12:57816495-57816517 AGTGGCTAGAAGCACAGGTTTGG - Intronic
1100285437 12:93161452-93161474 AGTTTGTAGAAGACCAAGATAGG - Intergenic
1101279134 12:103233022-103233044 AGTTGCTAGAAGAGCAGGATTGG - Intergenic
1105009442 12:132745630-132745652 AGTCGTTTGAAGACCAAGTTGGG + Intronic
1107553439 13:41497438-41497460 ACTATCTAGAGGACCAAGCTGGG - Intergenic
1109387429 13:61650371-61650393 AGTACCTTGAAGACTATGTTAGG - Intergenic
1110144362 13:72171060-72171082 AGTAGCTATGAGGACAAGTTTGG + Intergenic
1112148395 13:96728510-96728532 AGTGGGTAGAAGACAATGTTCGG - Intronic
1114261494 14:21039951-21039973 AGTAGAAAGGAGACCAAGCTAGG + Intronic
1116122887 14:40743079-40743101 AGGAGCTAGAAAACCTAGGTAGG + Intergenic
1118410598 14:65473566-65473588 AGTGTCTAGAATACCAAGTTTGG - Intronic
1119471782 14:74905002-74905024 AGTAGATAGAAAAACAAATTAGG + Exonic
1119665618 14:76482936-76482958 GGTAGTTAGAAGACCCAGTGAGG + Intronic
1120487021 14:85126903-85126925 GGTTGCTAGAAGACCAAAATTGG - Intergenic
1121293884 14:92800478-92800500 TGTAGCTAGCAAACAAAGTTGGG + Intronic
1122237049 14:100337260-100337282 ACTGGCTAGAAGCCCAAGTGTGG + Intronic
1126579416 15:50229404-50229426 AGTTGCTAGAAGAAAAAGCTGGG + Intronic
1127226410 15:56935189-56935211 GGCAGCAAGAAGACCAAGTAAGG - Intronic
1128589853 15:68886173-68886195 AGTACCTAGAAGAGCCTGTTGGG - Intronic
1129246812 15:74284076-74284098 AGAATCTTGAAGACCAATTTAGG + Intronic
1132033289 15:98456915-98456937 AGTAGAGAAAAGACCAAGTATGG + Intronic
1133343396 16:5053849-5053871 AATAGCTAGAAGAGCGAATTTGG + Intronic
1133700913 16:8307970-8307992 AGTAGTTAGAAAAATAAGTTTGG + Intergenic
1140424454 16:74849135-74849157 AGCAGCAGGAAGACCAAGGTTGG - Intergenic
1141128653 16:81419346-81419368 ACTAGCTAAAAGTCGAAGTTAGG + Intergenic
1145918150 17:28588980-28589002 AGTAGCTAAAAGACCACTGTTGG - Intronic
1149233170 17:54559725-54559747 AGTATGTAGTAGACCAAGATAGG - Intergenic
1153412028 18:4803890-4803912 AGAAGCTAGAAAACCAAGAGGGG - Intergenic
1156727842 18:40150568-40150590 AGTAGTTAGAAGATAAATTTTGG + Intergenic
1157860206 18:51134313-51134335 ACTGGCTCCAAGACCAAGTTTGG + Intergenic
1158185316 18:54764820-54764842 GGCAGTTAGAAGACAAAGTTTGG - Intronic
1158443569 18:57499282-57499304 AGTAGCTAGATGGCCAGATTGGG - Intergenic
1158515821 18:58129493-58129515 AGCAAGTAGAAAACCAAGTTGGG - Intronic
1158925982 18:62261022-62261044 AATAGCTAGAAGAGAAAATTTGG + Intronic
1159626377 18:70700025-70700047 AGTAGCTAGAAGAAAAGATTTGG - Intergenic
1166020495 19:40024512-40024534 AGTTGCTACAAGGGCAAGTTGGG - Intergenic
1166364232 19:42270357-42270379 AGTAGCTGGAAGACTGAGTCGGG + Intronic
1166523828 19:43498806-43498828 AGGAGCTAGAAGAGCATTTTGGG + Intronic
1167426454 19:49432250-49432272 AGCAGAGAGAAGACCGAGTTGGG - Intronic
925268933 2:2588434-2588456 AGTAGCTAAAAGACCACACTTGG - Intergenic
926727265 2:16008353-16008375 AGTATCTACAAGACAAAGTCAGG + Intergenic
927934932 2:27071078-27071100 AGTAGGTAGATGCCCAAGTTGGG - Intronic
929973363 2:46606226-46606248 AGAAGCTAGAGGACAAAGTAAGG - Intronic
932709194 2:74049275-74049297 AGTGGCCAGAAGACCAGGTCAGG + Intronic
935108514 2:100069363-100069385 AGTTGCTAGCAGTCCAATTTTGG + Intronic
940543632 2:155054808-155054830 TGTAGCCAGAAGACCCACTTGGG - Intergenic
943608920 2:190009089-190009111 AATAGCTAGAAGACCACTGTGGG + Intronic
943905527 2:193495743-193495765 AGAAGCTAGAAAACAAACTTCGG + Intergenic
944507894 2:200432421-200432443 GGCAGCTAAAAGAACAAGTTGGG - Intronic
947438006 2:230089892-230089914 AGCAGGTAGAAGACACAGTTTGG + Intergenic
948366247 2:237456658-237456680 ATTAGCTAGAAGAGGAAGTCTGG + Intergenic
1173126350 20:40339625-40339647 ACTTTCTGGAAGACCAAGTTTGG - Intergenic
1173754496 20:45503712-45503734 AATAGCTAGAAGAAAAACTTTGG + Intergenic
1174520051 20:51122329-51122351 AGCAGCCAGAAAAACAAGTTTGG + Intergenic
1176697820 21:10001992-10002014 GCTAGCTAGAAGCCCAAATTTGG - Intergenic
1176913083 21:14591790-14591812 AGGAGCTAGAATATCATGTTAGG - Intergenic
1176916390 21:14630932-14630954 AGTGGTTAGAATACCAACTTGGG + Intronic
1177718179 21:24867258-24867280 AGTAACAGCAAGACCAAGTTAGG + Intergenic
950019344 3:9776101-9776123 AGTAGGTTGAAGACCAGGCTGGG - Intronic
950922997 3:16714853-16714875 AGGAGCCAGAGGACAAAGTTGGG - Intergenic
953950142 3:47183263-47183285 GGTATGAAGAAGACCAAGTTGGG + Intergenic
958097953 3:88972034-88972056 AGTAGTTAGAAAACAAAGTGAGG + Intergenic
959876934 3:111394347-111394369 AGTAGCTAGAAGAGAAGATTTGG + Intronic
961231313 3:125313652-125313674 ACTGCCTAGAAAACCAAGTTTGG + Exonic
964409795 3:156386207-156386229 AGTAACTTGAAGAACAAGTGTGG + Intronic
964942978 3:162184070-162184092 AGTAGGTAGAAGACAAGATTGGG + Intergenic
966106717 3:176344270-176344292 AGGAACTAGAACACCAAGCTGGG - Intergenic
971522422 4:27570744-27570766 ACAAGCTAGAAGACCTAGTGTGG - Intergenic
972060885 4:34871810-34871832 AGTAGCAAGAAGATAAATTTGGG + Intergenic
972555679 4:40178596-40178618 GGTAGCTGGAAGACCAAGAGTGG - Intergenic
974023471 4:56711745-56711767 AGTAGAGAGAAGACCAAGAATGG - Intergenic
974240272 4:59237794-59237816 AGGAGCTAGAGAACAAAGTTGGG - Intergenic
974874664 4:67688272-67688294 AGCAGCTAGAAAACCAAGCCTGG + Intronic
975633802 4:76425915-76425937 TGTGGCAAGAAGAACAAGTTTGG - Intergenic
975874591 4:78820931-78820953 AGGAGCTAGAAGATAAAATTAGG - Intronic
976401810 4:84615469-84615491 AGTTGCTGGAAGACAAAGGTGGG - Intronic
977188075 4:93965751-93965773 AATAGCTAGAAGAGAAAATTTGG - Intergenic
978305418 4:107323119-107323141 AGTAGCTGGAGGCCCTAGTTGGG + Intergenic
979737837 4:124109951-124109973 AGTAGCCGGAAGTCCTAGTTTGG - Intergenic
980370367 4:131861865-131861887 GCTAGCTAGAAGCCCAAATTTGG - Intergenic
982947590 4:161644968-161644990 TATAGCTAGAAAACCAAGTCTGG - Intronic
984681759 4:182619135-182619157 AGGAGCTAGAAGGCCAGGTGTGG + Intronic
986077520 5:4353459-4353481 ATTAACTAGATGCCCAAGTTAGG - Intergenic
987220223 5:15783586-15783608 AGTAGCAAGAAAACCAAGGAGGG + Intronic
988250830 5:28755750-28755772 AGTAGATAAAAGAGAAAGTTAGG + Intergenic
989395262 5:40948730-40948752 ATCAGCTAAAAGACAAAGTTAGG - Intronic
990442008 5:55856023-55856045 AGTAGCTAGGATTACAAGTTTGG + Intronic
990840679 5:60076650-60076672 AGGAGCCAGAAAACAAAGTTGGG - Intronic
992368513 5:76118164-76118186 AGAAGCTAGAAGAGCAAGGAGGG - Intronic
992517849 5:77513773-77513795 AGGAGCTAGAAAAATAAGTTGGG - Intronic
993519942 5:88888551-88888573 AGTGACTACAAGACCAAGTTTGG - Intronic
994675561 5:102816967-102816989 AGGAAATAGAAGAGCAAGTTTGG - Intronic
995684432 5:114756987-114757009 AGTCGTTAGAAGACCAGTTTTGG + Intergenic
996153238 5:120065426-120065448 AGTACCTGAAAGAACAAGTTAGG - Intergenic
998275857 5:140753044-140753066 AGGAGCCAGAAAACAAAGTTGGG - Intergenic
998521235 5:142802764-142802786 AGTAGACAGTAGACCAAGTCTGG + Intronic
999927438 5:156394391-156394413 AATAGCTGGAAAACCAATTTGGG + Intronic
1001001610 5:168012839-168012861 ACTAGCTAGATGTCCAAGGTTGG + Intronic
1001068448 5:168560167-168560189 AGTTACTAGTAGACCATGTTGGG - Intronic
1005124339 6:22429291-22429313 AATAACTAGAAGACCTAATTTGG + Intergenic
1011035734 6:82972309-82972331 AGTAGCTAAGATACCAAGATTGG - Intronic
1011515812 6:88151409-88151431 AGGAGTTAGCAGACCAAGATTGG + Intronic
1015511289 6:134040482-134040504 ATTAACTAAAAGACCAAGTTGGG + Intronic
1022294747 7:29040149-29040171 AGCAGCCAGAAGAGGAAGTTTGG - Intronic
1022962770 7:35445418-35445440 AGATGCTAGACGACCATGTTTGG + Intergenic
1023754107 7:43399815-43399837 AGTAGCTAGCGGAGCAAGCTTGG + Intronic
1025607363 7:63048896-63048918 AGTACCAAGGGGACCAAGTTTGG - Intergenic
1029012850 7:97280985-97281007 AGAAGATAGAAAACTAAGTTTGG - Intergenic
1029485899 7:100840089-100840111 AGTATCTAGAAATCTAAGTTAGG - Intronic
1030284078 7:107807226-107807248 AATAGCTAGAAGAGAAAATTTGG - Intergenic
1030853612 7:114522432-114522454 AGTAGCTGGAAGACCAAGGAAGG - Intronic
1034985784 7:155514547-155514569 AGTATTCAGAAGACCAAGTTGGG - Intronic
1039545396 8:38406814-38406836 TGTAGCTAGAGGAGGAAGTTAGG + Intronic
1040404811 8:47089034-47089056 GGTAGCTGGAGGACCCAGTTGGG + Intergenic
1042113356 8:65405157-65405179 TGTGGCTAGTAGACCAAGTGTGG - Intergenic
1043672228 8:82901409-82901431 AATAGCTTGAAGAACAAGGTTGG - Intergenic
1043764606 8:84114532-84114554 AGTAGCTGGAACACCATGTGTGG + Intergenic
1044057334 8:87587340-87587362 AGAAGCTATGAGAACAAGTTAGG - Intronic
1044146145 8:88716409-88716431 AGGAGGTAGAATGCCAAGTTAGG - Intergenic
1044757134 8:95475631-95475653 AGTACCTTAAAAACCAAGTTTGG - Intergenic
1046588549 8:116177457-116177479 AGAATCTAGAAGACCATGTAAGG - Intergenic
1050186477 9:2980491-2980513 AGTAGATAAAAGAGCAAGATTGG + Intergenic
1050375984 9:4973603-4973625 AGTAGCAACAAGACCAATATGGG - Intergenic
1053634943 9:39988351-39988373 GCTAGCTAGAAGCCCAAATTTGG - Intergenic
1053770984 9:41475957-41475979 GCTAGCTAGAAGCCCAAATTTGG + Intergenic
1054208944 9:62262346-62262368 GCTAGCTAGAAGCCCAAATTTGG + Intergenic
1054549718 9:66387787-66387809 GCTAGCTAGAAGCCCAAATTTGG + Intergenic
1056597215 9:88017399-88017421 AATAGTTGGAAGAGCAAGTTGGG - Intergenic
1056629870 9:88284320-88284342 AGCAGATAAAAGACCAACTTAGG + Intergenic
1057962164 9:99467304-99467326 CATCGCTAGAAGACCAGGTTGGG + Intergenic
1058689734 9:107509511-107509533 AAGAGCTAGAAGACCAACTCTGG + Intergenic
1059684732 9:116624116-116624138 ATTAGCTAGCAAACCAAGCTGGG + Intronic
1060207381 9:121690208-121690230 AGTGGCAAGAAAACCACGTTTGG - Intronic
1061218948 9:129237748-129237770 AGTGGGTAGAGCACCAAGTTGGG - Intergenic
1187197605 X:17102691-17102713 ACAAGCTAGAAGACGGAGTTTGG - Intronic
1187738456 X:22328713-22328735 AGTAGCTAGAGAACTAAGTGGGG + Intergenic
1188352572 X:29150466-29150488 AGTAGAAAGAAGGCCAAGATGGG + Intronic
1189429824 X:40936535-40936557 AGTAGCAGGAAGACCCACTTGGG + Intergenic
1192614959 X:72610127-72610149 AGTAACTAGAAGAGCAGATTTGG - Intronic
1193020939 X:76792196-76792218 AATAGCTAGAAGAAAAAGTTTGG + Intergenic
1194301422 X:92191385-92191407 AGTAGATTGTAGACCAATTTAGG + Intronic
1196741174 X:119027368-119027390 AGTAGGGAGAAGAACAAGTTGGG - Intergenic
1197603034 X:128553227-128553249 AATAGCTAGAAGAGCAAATTTGG + Intergenic
1201565928 Y:15365346-15365368 AGTAGATAAATGACCACGTTCGG - Intergenic