ID: 1086602092

View in Genome Browser
Species Human (GRCh38)
Location 11:88645798-88645820
Sequence TTCAGGTAACAATGAAAAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 287
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 272}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086602092 Original CRISPR TTCAGGTAACAATGAAAAGG AGG Intronic
900724350 1:4205689-4205711 TTCTGTGAACACTGAAAAGGAGG - Intergenic
901380101 1:8867360-8867382 TTCTAGTAACAGTGAAATGGAGG - Intronic
904573220 1:31483699-31483721 TGAATGAAACAATGAAAAGGGGG + Intergenic
905716611 1:40157105-40157127 TTCAAGTAAGAATGAGAAGAGGG + Intergenic
905783439 1:40733015-40733037 TTCAGGAAAAAAAAAAAAGGGGG - Intronic
907523294 1:55039245-55039267 CCCAGGAAACACTGAAAAGGTGG + Intergenic
909428557 1:75557362-75557384 TGCAGGCAACATTGAAAATGTGG + Intronic
910799983 1:91135775-91135797 TTCAGATAACAATGAAAACCAGG - Intergenic
912262826 1:108126194-108126216 TTCAGGTAACAACATTAAGGGGG + Intergenic
912439981 1:109690354-109690376 TGCAGGAAACAAGGTAAAGGAGG + Exonic
918117017 1:181506462-181506484 TGCAGGTAAGAATGAACATGAGG - Intronic
918560325 1:185858377-185858399 TTCAGGTCAAAATGAAACTGCGG + Intronic
920636943 1:207713104-207713126 TTCAGAAAACAATGAAAAAATGG + Intronic
921660354 1:217793813-217793835 TTCAGTGAAAACTGAAAAGGAGG + Intronic
922018793 1:221682497-221682519 TTCAGGTATCAATGATAAAGAGG - Intergenic
923785098 1:237058831-237058853 ATCAGGTAGCAATTAGAAGGTGG + Intronic
924714689 1:246562332-246562354 TTTACGTAACAATGAAGAAGTGG - Intronic
1063303379 10:4874139-4874161 GTCAAGTAACAGTGAAAAGGTGG + Intergenic
1063582467 10:7321119-7321141 CTCAGTTAAAAAAGAAAAGGTGG + Intronic
1064529110 10:16289056-16289078 TGGATGTAAAAATGAAAAGGAGG - Intergenic
1064762724 10:18637684-18637706 TTCCGGTAATAATGAAAAACAGG + Intronic
1065313558 10:24439880-24439902 ATCAGGTTACATGGAAAAGGGGG - Intronic
1066547183 10:36512432-36512454 TTCATCTTACAAGGAAAAGGAGG - Intergenic
1068155696 10:53195086-53195108 TTGAGGTAAAAATTGAAAGGTGG - Intergenic
1068601999 10:58966483-58966505 ATCAGGTAAGAAAGAAAAGCTGG - Intergenic
1070204895 10:74248035-74248057 TTCATTCAACAATTAAAAGGAGG - Intronic
1070304008 10:75227316-75227338 TTCAGTTAGCATTGAAAATGAGG + Intronic
1070798073 10:79228703-79228725 CTCAGGGAACACTGAAATGGTGG - Intronic
1071924943 10:90395432-90395454 GTGAGGAAACAGTGAAAAGGTGG - Intergenic
1074440385 10:113472490-113472512 TTGAGGAGGCAATGAAAAGGAGG - Intergenic
1074591712 10:114820334-114820356 TTCATGGAACAGAGAAAAGGTGG - Intergenic
1075493407 10:122894878-122894900 TCTAGGAAACATTGAAAAGGAGG + Intergenic
1076120327 10:127931634-127931656 TTTGGGTAACGATGCAAAGGGGG - Intronic
1076352688 10:129828856-129828878 ATCAGGTGACCATGAATAGGAGG + Intergenic
1079052301 11:17172818-17172840 ATAAGTTAACAATGCAAAGGAGG - Intronic
1079527530 11:21408408-21408430 TTCAGACTACAAAGAAAAGGAGG + Intronic
1079931528 11:26569197-26569219 TTCAAGTTACAATCAAAAGCTGG - Intronic
1080738935 11:35045701-35045723 TTCAGCTCAGAGTGAAAAGGTGG - Intergenic
1080992424 11:37554153-37554175 TTCAGGTAAAAATGACCAGTTGG + Intergenic
1081335441 11:41859982-41860004 TTCAGGTGATATTGAAATGGAGG + Intergenic
1083054242 11:59804487-59804509 TTAAGGTACCAATGAGAACGTGG + Intergenic
1083232993 11:61334893-61334915 TCCAGGAAACAAAGAAAAGCAGG - Intronic
1084290919 11:68166518-68166540 GTCAGCAAGCAATGAAAAGGTGG + Intronic
1085368208 11:75973210-75973232 TTCAGCTAACTAGGAAAAGAGGG - Intronic
1085932326 11:81098433-81098455 TTCAGGTAAAAAAAAAAGGGAGG + Intergenic
1086195064 11:84128023-84128045 TTGAGCAAACATTGAAAAGGGGG - Intronic
1086436682 11:86788192-86788214 TCCAGGAGACAATCAAAAGGGGG - Intergenic
1086512297 11:87572166-87572188 TCCAGGTATTAAAGAAAAGGAGG + Intergenic
1086602092 11:88645798-88645820 TTCAGGTAACAATGAAAAGGAGG + Intronic
1088187524 11:107188438-107188460 TTCAGTTAATAATAAAAAGATGG + Intergenic
1088333010 11:108672467-108672489 TTCAGATATCACTGGAAAGGAGG - Intronic
1088384691 11:109240404-109240426 TTTAGGTAACAATTAATAGAAGG - Intergenic
1088426135 11:109705604-109705626 TTCAGGTTCCAAAGAAAAGATGG - Intergenic
1088446786 11:109939286-109939308 TTCAGGTAACAGTGGAAAGCTGG + Intergenic
1089946459 11:122479239-122479261 AGCAGGAAACAATTAAAAGGAGG - Intergenic
1090997531 11:131880401-131880423 TCAAGGTAACAATGCAAATGAGG + Intronic
1091736452 12:2926193-2926215 TTCTGCTACCAATAAAAAGGGGG + Intronic
1092600311 12:10053864-10053886 TTCAAGTAACACTGAAGAGATGG + Intronic
1092995064 12:13941832-13941854 ATCAGGTGAGAATGAAAATGAGG + Intronic
1093033912 12:14315095-14315117 TTCAGTCAGCAAGGAAAAGGAGG - Intergenic
1094132427 12:27088578-27088600 TTCAGGAAAGAAATAAAAGGGGG - Intergenic
1094162076 12:27402012-27402034 TGCAGGTAAAAATGACAGGGAGG - Intronic
1094181906 12:27600588-27600610 TTCAGGAAAGAAATAAAAGGGGG - Intronic
1094284017 12:28772316-28772338 TTCAGGTCACACAGAAATGGTGG + Intergenic
1096218501 12:49811898-49811920 TTAAGGGAACAATGAGAAGATGG - Intronic
1098916858 12:76266614-76266636 TATAGGTAACAATGAAGAGAGGG - Intergenic
1098929912 12:76399324-76399346 TTCAGATAAGAATGAGAAAGAGG + Intronic
1100080553 12:90844143-90844165 TTGAGGAACTAATGAAAAGGTGG + Intergenic
1100858700 12:98781629-98781651 TGAAGGTAACTAGGAAAAGGGGG - Intronic
1106187438 13:27421775-27421797 ATCAGGTAACAATGCTCAGGTGG - Intergenic
1107266337 13:38560603-38560625 TTGATGTAGCAATGCAAAGGTGG + Intergenic
1109185726 13:59265339-59265361 TTCAGCTAAGAATGAGAGGGTGG + Intergenic
1109758517 13:66795006-66795028 TTGAAATAAGAATGAAAAGGAGG + Intronic
1109768528 13:66937343-66937365 TTCAGATAACTAAGAACAGGCGG - Intronic
1110052254 13:70918949-70918971 TTGAGATGAGAATGAAAAGGTGG + Intergenic
1110067725 13:71129829-71129851 TTCAGGTACCAATCAAACGTAGG - Intergenic
1111329255 13:86742863-86742885 TTCAAGCAACAATGAGAAGAAGG + Intergenic
1112481357 13:99778687-99778709 TGCATTTAACAATGAAAAGGAGG - Intronic
1113134921 13:107078799-107078821 TTTAGGGAACACTAAAAAGGGGG - Intergenic
1113631721 13:111892821-111892843 TTCAAATCACAATGAAAAAGAGG + Intergenic
1114843598 14:26294491-26294513 GTCAAGTAACCATGAAAAGTTGG + Intergenic
1114856813 14:26457029-26457051 TTCAGGTAAAACAGAAAGGGAGG + Intronic
1115445307 14:33483107-33483129 ATGTGGTAACAATGAAAAGCTGG + Intronic
1119877653 14:78074509-78074531 TTCTGGAAACCAAGAAAAGGAGG + Intergenic
1120433402 14:84448458-84448480 GTCATTTAACAATGGAAAGGTGG + Intergenic
1120465515 14:84852162-84852184 TTTTGGTCCCAATGAAAAGGAGG + Intergenic
1120710086 14:87784294-87784316 TTCATGTATCACTGGAAAGGAGG - Intergenic
1120739128 14:88088577-88088599 ATAAGGTAGCAATGAAAAGCAGG + Intergenic
1120900581 14:89572105-89572127 TTTCGGTAACAATGGAATGGAGG + Intronic
1122626828 14:103089294-103089316 CTCTGGCCACAATGAAAAGGGGG - Intergenic
1123206200 14:106715567-106715589 CACTGGTAACACTGAAAAGGTGG + Intergenic
1123211283 14:106762977-106762999 CACTGGTAACACTGAAAAGGTGG + Intergenic
1123801546 15:23826240-23826262 TTCTGGTAACAGTAAAAAGCTGG - Intergenic
1124048407 15:26172677-26172699 CTATTGTAACAATGAAAAGGAGG - Intergenic
1125458391 15:39884737-39884759 TCCTGGTAAAAATGAAAAGCTGG - Intronic
1126228961 15:46303332-46303354 TTCGGGTAACAAAGGAAAGCAGG + Intergenic
1127215409 15:56818344-56818366 GAAAGGTAAGAATGAAAAGGAGG + Intronic
1127738173 15:61867566-61867588 TTCAGGTAAAATTGAAAAACAGG - Intronic
1130862532 15:87903785-87903807 TTGGGATAGCAATGAAAAGGGGG + Intronic
1133311772 16:4852858-4852880 TTCTGTTAACATTGAAAAGAAGG - Exonic
1133895730 16:9927147-9927169 TTCTGTTAACAATGAGAAAGAGG - Intronic
1134866306 16:17610423-17610445 TTCAGGCCACAATGAGAAGTGGG + Intergenic
1136242067 16:28950855-28950877 TACAGAGACCAATGAAAAGGCGG + Intronic
1140279673 16:73543420-73543442 TCCAGGTCACAAGGAAAGGGGGG - Intergenic
1142985192 17:3691081-3691103 TTCAGGTAACGCTGGAAAGGTGG - Intronic
1143768792 17:9154623-9154645 TTCAGGAGACGCTGAAAAGGGGG + Intronic
1143828371 17:9631214-9631236 TCCAGGTAAGAAGGTAAAGGAGG - Intronic
1144157490 17:12520574-12520596 TCCAAGTAACAAGGAAAAGATGG - Intergenic
1145764204 17:27447101-27447123 TTAAGGTCACATTGCAAAGGAGG + Intergenic
1147047963 17:37768787-37768809 TTCAGCCAGCAATGAAATGGAGG + Intergenic
1148983524 17:51600082-51600104 TTCAGGTCATGATGAGAAGGGGG + Intergenic
1149441120 17:56674780-56674802 CTCAGGTGACAAAGAAAAAGTGG + Intergenic
1149934069 17:60785884-60785906 TATAGGCAATAATGAAAAGGGGG - Intronic
1151036522 17:70806274-70806296 TTCAGGCAACCATCAGAAGGGGG + Intergenic
1153026883 18:680467-680489 TTCAGGAAATATTGAAAAGGAGG - Intronic
1153805020 18:8704129-8704151 GTCAGGTAATAATTACAAGGAGG - Intergenic
1155250844 18:23951819-23951841 TTCAAGTCAAAATGGAAAGGGGG - Intronic
1156641796 18:39109984-39110006 TTGAGGTCACAATGAGAAAGTGG + Intergenic
1156773126 18:40754223-40754245 GTCAGGTAAAAATGACAAAGTGG - Intergenic
1157407360 18:47433447-47433469 TTCGGTTAACAAGGAAAAAGTGG + Intergenic
1158294014 18:55973751-55973773 TTCAGGTATAAAAGAAAAAGGGG + Intergenic
1159117396 18:64131018-64131040 TTCACAGACCAATGAAAAGGGGG + Intergenic
1159531889 18:69665499-69665521 TTCAGATAACAATGGACTGGTGG - Intronic
1164259417 19:23556485-23556507 TTCAGGTAAACATGGAAAAGTGG + Intronic
1164542472 19:29131107-29131129 TTCAGGGAACATTGGGAAGGGGG + Intergenic
1165416335 19:35696048-35696070 ATGAGGTCACAGTGAAAAGGTGG + Intergenic
1166447445 19:42870533-42870555 AAGAGGTAACCATGAAAAGGTGG - Intronic
925965651 2:9062897-9062919 TTCAAGAAAGAAAGAAAAGGAGG + Intergenic
927249313 2:20983521-20983543 TTCAGGTGACAATAATGAGGAGG + Intergenic
928599608 2:32891163-32891185 GCCAGTGAACAATGAAAAGGAGG - Intergenic
929951508 2:46413449-46413471 TAGAGGTAATAAGGAAAAGGAGG + Intergenic
930010842 2:46937416-46937438 TTCAGCTAAAAATGAAAACAGGG - Intronic
930833677 2:55772855-55772877 TTTATGTAACAATGCGAAGGAGG + Intergenic
930938292 2:56982772-56982794 TTCTGGTAAAAATGGAAAAGTGG - Intergenic
931858258 2:66326977-66326999 TTCTGCTATCAATGCAAAGGTGG + Intergenic
932086656 2:68768617-68768639 TTCAGGAACCAAAGAAAAGATGG - Intronic
933193979 2:79368504-79368526 ATCAGATAACATTGAAAAAGAGG - Intronic
936349003 2:111698426-111698448 TTCAGATAGAACTGAAAAGGAGG - Intergenic
937851543 2:126640445-126640467 TGCAGAAAAAAATGAAAAGGAGG - Intergenic
938365464 2:130729793-130729815 TGTAGGTAACAATGACCAGGAGG - Exonic
938760665 2:134422944-134422966 TTCAGGTCACATTAGAAAGGAGG - Intronic
938973794 2:136456495-136456517 TTCAGGTCAGAATGGGAAGGGGG + Intergenic
939210565 2:139170093-139170115 TTCAGGTAAGGCTGACAAGGTGG - Intergenic
939902032 2:147862342-147862364 TTCAGGCAACAATTAACATGTGG - Intronic
941200407 2:162501667-162501689 GTGAGGTTACAATGAAAAGATGG - Intronic
941469560 2:165867801-165867823 TTCAGGAAACTATGTAAGGGAGG + Intronic
941628627 2:167859316-167859338 CTCAGGGAAAAATGAAAATGAGG - Intergenic
942259878 2:174148721-174148743 GTTAGGTAACAACAAAAAGGGGG - Intronic
942433510 2:175943744-175943766 TTCAGCTAACTAAGAATAGGTGG + Intronic
943487646 2:188507054-188507076 TTCAGGAAAGAATGCAAAGTGGG - Intronic
943701344 2:190991210-190991232 TTGAGGTAACAAGGGAAAGATGG - Exonic
944307080 2:198190896-198190918 GTGAGGATACAATGAAAAGGTGG + Intronic
945061239 2:205910686-205910708 TTCAGCTAATAATGACAATGGGG - Intergenic
946281734 2:218670870-218670892 CTCAGTTATTAATGAAAAGGAGG + Intronic
946660697 2:221996444-221996466 TTTAGGTATCAAAGAATAGGTGG - Intergenic
947556106 2:231094656-231094678 TTCTGGTAAAAATGGAAAAGTGG - Intronic
1168873123 20:1147824-1147846 TTCAGGGAGAAAGGAAAAGGTGG - Intronic
1169781243 20:9313053-9313075 TTGATGTAACAATGAAAAGAGGG + Intronic
1170285271 20:14701308-14701330 CTCAGGATAGAATGAAAAGGTGG - Intronic
1170406741 20:16045859-16045881 CTCAGGTAGCAGTGTAAAGGAGG - Intronic
1171025741 20:21628991-21629013 TTCAGTGAACAATGACAATGAGG + Intergenic
1171945454 20:31372898-31372920 TGCAGGAAACAATGCAAAGATGG + Exonic
1173782857 20:45771127-45771149 TTCTGGTAACATTGATATGGGGG - Intronic
1175359960 20:58401833-58401855 TGGAGGAAAAAATGAAAAGGTGG - Intronic
1175577164 20:60069000-60069022 TTCAGTTAATAATCACAAGGTGG + Intronic
1177202777 21:17976486-17976508 TTCATGTGACAATGAGAAGTTGG + Intronic
1179098968 21:38339857-38339879 GTAAGGAAACAGTGAAAAGGTGG - Intergenic
949160648 3:877835-877857 TTAAGTTAACAAGGAAAAGAAGG + Intergenic
949943032 3:9169422-9169444 TTCAAGCAGCAAAGAAAAGGTGG + Intronic
951282769 3:20773169-20773191 TTCAGATAACAGTGAAACAGTGG + Intergenic
951489480 3:23253656-23253678 TACCTGTAACAATGAAAATGTGG + Intronic
952196181 3:31077641-31077663 TTTAGGTAACAATGTGAGGGAGG - Intergenic
953362155 3:42307276-42307298 GTCATGAAACAATAAAAAGGGGG + Intergenic
954958670 3:54545462-54545484 TGCAAATAACAATGAAAAAGGGG - Intronic
955131108 3:56169739-56169761 TCTAGCTAACAATGAAAAAGGGG + Intronic
956244440 3:67166068-67166090 TTCATGAAACTATGCAAAGGAGG - Intergenic
957839231 3:85644860-85644882 TTCAGGAAGCAATGAAAAACTGG - Intronic
959586418 3:108029239-108029261 TTCAGTTAACAAAAAAAAGAGGG - Intergenic
959876716 3:111391195-111391217 TTCCAGTAAAATTGAAAAGGAGG + Intronic
959996271 3:112684029-112684051 TACTGGTATAAATGAAAAGGAGG - Intergenic
961200963 3:125045003-125045025 TTCATGTAAGTAAGAAAAGGTGG + Intronic
964742871 3:159985984-159986006 CTAAGGGAATAATGAAAAGGGGG - Intergenic
964818956 3:160749092-160749114 TTCAGGTAGCTAGGAATAGGAGG + Intergenic
965147034 3:164918964-164918986 ATGAGGTAACAAAGAAAAAGAGG - Intergenic
965862767 3:173167098-173167120 TTCAGGTAAAGATGAAACAGGGG + Intergenic
966345844 3:178978767-178978789 TTCAGGTAACAAAGAAAAATTGG - Intergenic
967148776 3:186629041-186629063 TTTAGGTAACAGTGAAAAGGAGG - Intergenic
968029611 3:195472492-195472514 TTCATGTAACAAAAAATAGGGGG + Intergenic
971609432 4:28703511-28703533 TTCAGGTTGTAATGACAAGGAGG - Intergenic
971847676 4:31941529-31941551 TTGAGGACACAGTGAAAAGGTGG + Intergenic
977233100 4:94475141-94475163 TTTAGGTAAAAAAAAAAAGGCGG - Intronic
977448869 4:97168342-97168364 TTCAGTTGACACTGAAATGGAGG - Intergenic
977568412 4:98605929-98605951 CTCAGGTAACAAGGACAAGCTGG - Intronic
978102289 4:104857025-104857047 GTCAAGTAACAATGTAAAAGAGG + Intergenic
978742473 4:112152735-112152757 ATTATGAAACAATGAAAAGGGGG + Intronic
980444878 4:132892026-132892048 TCCAGCTAAAATTGAAAAGGAGG + Intergenic
982596449 4:157391287-157391309 TTCTACTAACAATGAATAGGTGG - Intergenic
982851399 4:160320286-160320308 TGCAGAAAACAATAAAAAGGAGG - Intergenic
983116150 4:163818894-163818916 TGCTGCTAACAATGAGAAGGTGG - Intronic
983855185 4:172634372-172634394 TTCAGGTAAAGATGAAAATCTGG - Intronic
985344476 4:188988579-188988601 GTGAGGACACAATGAAAAGGCGG + Intergenic
985616411 5:924824-924846 TTCAGGTGATAAAGAAAAAGCGG - Intergenic
987961706 5:24818381-24818403 GTCATGTAACAATTTAAAGGTGG + Intergenic
989220020 5:38947676-38947698 CTCAGGTAAAGGTGAAAAGGTGG + Intronic
989610219 5:43283643-43283665 TCCAGTGCACAATGAAAAGGAGG - Intergenic
990315616 5:54580671-54580693 TTCAGGAGAAAATGAAAAGGAGG - Intergenic
990331094 5:54726220-54726242 TCCAGGAGACAATGAAAAGAAGG - Intergenic
991945320 5:71893835-71893857 TCCAGGTAAAAATGACAAGTGGG + Intergenic
993200158 5:84805523-84805545 TTCAGGGAAAAATGGAAGGGGGG + Intergenic
993874295 5:93288397-93288419 TTCAAGTTTCAATGAAAAGATGG + Intergenic
993885132 5:93407425-93407447 TTTAGAGAACAATGAAAATGTGG + Intergenic
994202727 5:96996400-96996422 ATCTGGTAACAATGAAGTGGTGG + Exonic
995869286 5:116727162-116727184 TTCAGGTAACAAGAAGAAAGAGG - Intergenic
998639537 5:143994279-143994301 TTGGGGTAATAATGATAAGGGGG - Intergenic
998909966 5:146948517-146948539 TAAATGTAACAATGAAAAGAAGG + Intronic
1000114842 5:158143990-158144012 TTGATGTAACAATGAAAGGTTGG - Intergenic
1000360605 5:160443210-160443232 TTCATGAAACAAAGAACAGGAGG + Intergenic
1000459803 5:161500425-161500447 TCCTGGTAACAATCAAATGGAGG - Intronic
1000924636 5:167178883-167178905 TTAAGGTAACAAGAAAAAGTTGG - Intergenic
1004207441 6:13605445-13605467 TTTAGGTAACAAAGAAAATCAGG - Intronic
1004509056 6:16269922-16269944 ATGAGGTGACAATGAAAAGATGG - Intronic
1004708175 6:18143930-18143952 TTCAGGAAACAATAAAAATTTGG + Intronic
1005302826 6:24487765-24487787 GTCAGGAAACAATGGAAAAGAGG - Intronic
1005649505 6:27873649-27873671 TTCAGGAAAAAATGGAAAAGGGG + Intergenic
1006080281 6:31561239-31561261 TCCAGGTGACGATGAAAAAGAGG + Intergenic
1007880148 6:45155709-45155731 ATTATGTAACAGTGAAAAGGAGG - Intronic
1009735719 6:67674138-67674160 TTCAGGATACATTCAAAAGGGGG + Intergenic
1010992553 6:82496209-82496231 TTCAGGTAATGATATAAAGGAGG + Intergenic
1011750556 6:90450744-90450766 TTCAGGTCATGATGGAAAGGTGG - Intergenic
1013576518 6:111488669-111488691 TTGAGATAACAATTTAAAGGTGG + Intergenic
1014722746 6:124938090-124938112 TTAAGGTAAGAATGGAAGGGTGG + Intergenic
1015510312 6:134031741-134031763 TTCAGGTAAAAATGTTAAGTAGG + Intronic
1016192147 6:141282808-141282830 CTCAGGAAACAAAGAAAATGAGG + Intergenic
1017313128 6:152997846-152997868 ATCAGGAAACAAAAAAAAGGAGG - Intronic
1017521622 6:155207782-155207804 TTCAGGTAAGCATGAGAAAGGGG - Intronic
1017979158 6:159383876-159383898 TTCAGGAGAAAATGAAAAGGAGG + Intergenic
1018863208 6:167727268-167727290 TTCAGGTACCAATGCAGTGGGGG - Intergenic
1020756870 7:12213893-12213915 TTCAGGCCATGATGAAAAGGTGG + Intronic
1021450872 7:20783592-20783614 CTCAGGGAACAAAGAAAAAGAGG + Intronic
1022162234 7:27722937-27722959 TTCAGTTACCTCTGAAAAGGCGG + Intergenic
1022265126 7:28746164-28746186 TTCACGTAATACTAAAAAGGGGG - Intronic
1027344687 7:77245728-77245750 ATCTGGTAACAAAGGAAAGGAGG + Intronic
1028899750 7:96084231-96084253 TTCAGTGAAAAATGAAAATGTGG - Intronic
1030660898 7:112218230-112218252 ATCAGGTAACAATGTACTGGAGG + Intronic
1032794351 7:135265772-135265794 GTGAGGTTACAATGAGAAGGTGG + Intergenic
1036109064 8:5877687-5877709 TTCAGGTAAACATGGAAAAGTGG - Intergenic
1037898835 8:22675825-22675847 ATCTGGTCACAGTGAAAAGGTGG + Intergenic
1038322574 8:26541552-26541574 TTCATGTAACACTGTAAAGATGG + Intronic
1039121455 8:34152505-34152527 TTGAGGTCACAATGAAAAGATGG - Intergenic
1039295547 8:36148069-36148091 TGCAGGTAACAATGGAAGTGTGG + Intergenic
1040614966 8:49026175-49026197 TTCAGGTTCCATTGAAAAGGAGG - Intergenic
1042556776 8:70039923-70039945 CTCAATTAACAAAGAAAAGGGGG + Intergenic
1042574217 8:70200010-70200032 TTTAGGGAATAATGACAAGGGGG - Intronic
1043511096 8:80950831-80950853 TTCAGGTTAGAAAGAAAAAGGGG - Intergenic
1044137903 8:88610260-88610282 TTCAGGTAAACATGGAAAAGCGG - Intergenic
1044974671 8:97652236-97652258 TTCAGCTTAGAATGAAAAGCAGG - Intronic
1045781886 8:105875252-105875274 TTCAGTTAACAATGTAAAAAAGG - Intergenic
1046719648 8:117605038-117605060 TTCATGGAACAAGTAAAAGGCGG + Intergenic
1050099054 9:2099196-2099218 TTAAGGTACCAATGAATTGGTGG + Intronic
1050627196 9:7517780-7517802 TTCTGGAAAAAAAGAAAAGGAGG - Intergenic
1051340128 9:16103201-16103223 TTTAAGTAACAAAGATAAGGGGG + Intergenic
1051655672 9:19379614-19379636 TTCAGCTAAGGATTAAAAGGGGG + Exonic
1052077698 9:24164110-24164132 TTAAAGAAACAATGCAAAGGAGG - Intergenic
1052353118 9:27477175-27477197 TCAAGGAAACAATGAAAATGTGG - Intronic
1052681146 9:31694657-31694679 TGCAAGTAACCATGAATAGGAGG - Intergenic
1052704534 9:31979552-31979574 TTCAGGTAGAAATGAAAGGATGG - Intergenic
1053592406 9:39527586-39527608 GTAAGCAAACAATGAAAAGGAGG + Intergenic
1053850252 9:42282928-42282950 GTAAGCAAACAATGAAAAGGAGG + Intergenic
1054573895 9:66837693-66837715 GTAAGCAAACAATGAAAAGGAGG - Intergenic
1055669223 9:78583566-78583588 ATCAGGTAACAAGAAAAGGGTGG + Intergenic
1056631263 9:88294991-88295013 TTTGGGTATAAATGAAAAGGAGG - Intergenic
1057122594 9:92589621-92589643 TGCAGGTAAAAATGTAAAGAAGG - Intronic
1058079815 9:100689900-100689922 TAGAGGTAACAATAAGAAGGAGG + Intergenic
1187795077 X:22994730-22994752 GTGAGGTTACAATGGAAAGGTGG - Intergenic
1188103638 X:26121783-26121805 TCCAGTTAAAAATGAAAACGTGG - Intergenic
1191778700 X:64845091-64845113 TTCAGGTAAATCTGAATAGGTGG - Intergenic
1191786709 X:64924029-64924051 TTCACGTAACCTAGAAAAGGAGG - Intronic
1193780147 X:85691429-85691451 TTCAGAAAGCAATGAAAAAGAGG - Intergenic
1193972199 X:88068332-88068354 TTCAGGCCATAATGAGAAGGGGG - Intergenic
1194824139 X:98541008-98541030 TTCAGGTCATGATGGAAAGGGGG - Intergenic
1195642834 X:107196049-107196071 TTCTGGTAGCCATCAAAAGGTGG + Intronic
1196029723 X:111083580-111083602 TTCAGGTGGCAAAGGAAAGGAGG - Intronic
1196549293 X:117002996-117003018 TTTAGGTAACAATGAAAGTCAGG - Intergenic
1197592494 X:128425650-128425672 TTCAAGTAGAGATGAAAAGGAGG - Intergenic
1198457939 X:136835849-136835871 TGCTGGTAACAATGTAAAAGTGG - Intergenic
1199151109 X:144488134-144488156 TTCAGGGAAAAAGGAAAAGAAGG - Intergenic
1200425437 Y:3015453-3015475 TTCAGGCCATAATGAGAAGGCGG - Intergenic