ID: 1086604463

View in Genome Browser
Species Human (GRCh38)
Location 11:88679897-88679919
Sequence AAGAAGATGAAGAATGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2074
Summary {0: 1, 1: 3, 2: 15, 3: 263, 4: 1792}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086604463 Original CRISPR AAGAAGATGAAGAATGAGGA AGG (reversed) Intronic
Too many off-targets to display for this crispr