ID: 1086606047

View in Genome Browser
Species Human (GRCh38)
Location 11:88697477-88697499
Sequence TGATCTTGCATTGCTTCTAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 183
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 166}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1086606047_1086606049 30 Left 1086606047 11:88697477-88697499 CCTGTAGAAGCAATGCAAGATCA 0: 1
1: 0
2: 0
3: 16
4: 166
Right 1086606049 11:88697530-88697552 AATGTACAAGTGCAGCCACAAGG 0: 1
1: 0
2: 0
3: 16
4: 156

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086606047 Original CRISPR TGATCTTGCATTGCTTCTAC AGG (reversed) Intronic
900519852 1:3100264-3100286 TGATGTGGCGTTGCTGCTACAGG - Intronic
903042902 1:20544875-20544897 TGATCTGGCAGTGCTACTTCTGG + Intergenic
904382425 1:30120323-30120345 TGATGTTGTTTTGCTTCTGCAGG - Intergenic
904441542 1:30535052-30535074 TGATGTTGTTTTGCTTCTGCAGG - Intergenic
909340170 1:74522833-74522855 TAATCTTGAATTCCTTCTACAGG - Intronic
910359132 1:86396831-86396853 AAATCTTGCTTTGCTTCTTCAGG - Intergenic
910391856 1:86753997-86754019 TCATCTTTCATTGTTTCTGCAGG - Intergenic
912387263 1:109277737-109277759 TGACCTTCCAGTGCTTCTATTGG + Intergenic
918400965 1:184162548-184162570 GGGTCTTGCATTCCTTCTCCCGG - Intergenic
922178655 1:223216538-223216560 TGATTTTGCACTGCCTCTGCAGG + Intergenic
922273538 1:224056179-224056201 TGATCTGGCATTCCTTCTCTTGG + Intergenic
923082485 1:230671765-230671787 TGTTATTTCATTGTTTCTACTGG + Intronic
1064937924 10:20700131-20700153 TGTTCCTCCCTTGCTTCTACAGG + Intergenic
1066043218 10:31573401-31573423 TAATATTACATTGCTTATACAGG - Intergenic
1068735321 10:60407830-60407852 TCATTTTGCATTGCTTCAAAGGG - Intronic
1068753307 10:60621893-60621915 TGATCTTGCATTGTTATTCCAGG - Intronic
1070375184 10:75823598-75823620 TGATCTTGCAATCCCACTACTGG + Intronic
1070641284 10:78172087-78172109 TGATGTTGCATTTCTTCTCAGGG + Intergenic
1074663954 10:115696525-115696547 TGATCTAGCAATCCTACTACTGG - Intronic
1075487057 10:122831102-122831124 TGAACATGCATTGCATCTACAGG - Intergenic
1077839427 11:5959141-5959163 TGATCTAGCATTCCCACTACTGG - Intergenic
1078654402 11:13225042-13225064 TGATATGGCATTGCCTCTTCTGG - Intergenic
1080044862 11:27798097-27798119 GGGTTTTGCATTGCTTCTTCTGG - Intergenic
1080541386 11:33268850-33268872 TGATTTTGCATTAATTCTATTGG + Intronic
1080863832 11:36175328-36175350 TGTTCTTTCATTTCTTCTGCTGG + Intronic
1081630035 11:44683040-44683062 TCTTCTTGCAATGCTTCTACAGG - Intergenic
1082211204 11:49504277-49504299 TGATCTTGCAATCCCACTACTGG + Intergenic
1086069501 11:82785138-82785160 TGATCTGGCAATACTACTACTGG + Intergenic
1086606047 11:88697477-88697499 TGATCTTGCATTGCTTCTACAGG - Intronic
1086638439 11:89120777-89120799 TGATCTTGCAATCCCACTACTGG - Intergenic
1087538549 11:99484506-99484528 TGATCTAGCAATGCCACTACTGG + Intronic
1088601751 11:111485722-111485744 TGATCTTTCACTTCTTCTACTGG - Intronic
1090157255 11:124453179-124453201 TGATCTAGCAATTCTGCTACTGG + Intergenic
1090336976 11:125975827-125975849 TGTTCTTACATTCCTTCTACGGG + Intronic
1092941743 12:13415593-13415615 TGATCTAGCAATTCTACTACTGG + Intergenic
1093202260 12:16202580-16202602 TGATCCAGCAATGCTACTACTGG + Intronic
1096861269 12:54530209-54530231 TAAACTTGCCTTTCTTCTACTGG + Intronic
1097423653 12:59414012-59414034 TCATCTTGCATTGGATTTACAGG - Intergenic
1097586512 12:61522295-61522317 TCAACTTCCATTTCTTCTACAGG + Intergenic
1097957390 12:65500352-65500374 TGATCTGGCATTGCTGCTTCTGG - Intergenic
1100608951 12:96175018-96175040 TGATCCAGCATTTCTACTACTGG - Intergenic
1101017920 12:100520714-100520736 TGTTCTTCCGTTGTTTCTACTGG - Intronic
1101484619 12:105141413-105141435 TTATTTAGCTTTGCTTCTACAGG + Intronic
1102709417 12:114912803-114912825 TGATCTAGCAATCCTACTACTGG + Intergenic
1104196299 12:126541807-126541829 TTATCTTGCATTGATCCTACTGG - Intergenic
1106388736 13:29314800-29314822 TGATCTAGCAGTTCTACTACTGG + Intronic
1106979858 13:35266313-35266335 TGATCTAGCAGTTTTTCTACTGG + Intronic
1108488543 13:50953926-50953948 TAATCTTCTTTTGCTTCTACAGG - Exonic
1109824646 13:67702273-67702295 TGATCTGGCAATCCTACTACTGG + Intergenic
1109947484 13:69456167-69456189 TGATCTTCCTTTGCTTTGACTGG + Intergenic
1110347236 13:74462912-74462934 TGTTCTTGCATTGTTTCCACTGG - Intergenic
1111689727 13:91548542-91548564 TGAGATTGCATTGAATCTACAGG - Intronic
1111804700 13:93024930-93024952 TGATCCTGCATTGGTTTTTCAGG + Intergenic
1114768790 14:25405481-25405503 TGATCTAGCAATCCCTCTACTGG + Intergenic
1115329093 14:32174919-32174941 TGATCTAGCAATCCTACTACTGG - Intergenic
1115456024 14:33603274-33603296 TCATTTTGCATAGTTTCTACTGG - Intronic
1116313407 14:43355737-43355759 TGATCCTGCAATCCTACTACTGG - Intergenic
1116428087 14:44814631-44814653 TGAAATTGCATTGCTTCTTCAGG - Intergenic
1117581180 14:57153296-57153318 TCAGCTTGCATTGTTTCTGCTGG - Intergenic
1117966461 14:61211453-61211475 TGTTCTTGTATAGCTTTTACTGG + Intronic
1118133303 14:62992340-62992362 TGATCTGGCAGTCCTGCTACTGG - Intronic
1122419371 14:101565400-101565422 TGAGCTTGCATTGCTTTCATAGG - Intergenic
1202942382 14_KI270725v1_random:164228-164250 TGAAATTGCATTGTTTCTACCGG - Intergenic
1124441546 15:29689389-29689411 TGATCTGTCCTTGCATCTACTGG + Intergenic
1126291035 15:47079273-47079295 CGAAATTGCATTGTTTCTACCGG + Intergenic
1130069594 15:80635308-80635330 TGAGGTTGCATTGCTCCTGCTGG + Intergenic
1130992571 15:88884894-88884916 TGTTCTTGCCTTGCCTCTTCCGG - Intronic
1136986712 16:35113126-35113148 TGTCCCTGCATTGCATCTACAGG + Intergenic
1136993585 16:35172658-35172680 TGTTCTGGCATTGCATCTACAGG + Intergenic
1137026758 16:35484609-35484631 TGATCCTGCACTTCCTCTACTGG + Intergenic
1139368746 16:66451492-66451514 TGACCTTGCATTTCTTAAACAGG - Intronic
1143336704 17:6176799-6176821 TGATCTACCATGGTTTCTACGGG - Intergenic
1150503243 17:65671349-65671371 GGATCTTGCACTGTGTCTACGGG + Intronic
1150945042 17:69736038-69736060 TGATCTGGCAATCCTACTACTGG - Intergenic
1154316549 18:13308633-13308655 TGAATTTGCATTTCTTTTACTGG + Intronic
1154410442 18:14138240-14138262 TGATCTAGCATTGCTGTTTCTGG - Intergenic
1158331210 18:56364867-56364889 TGATCTAGCAATCCTTCTACTGG - Intergenic
1162243095 19:9373462-9373484 TGATCTAGCAATCCTGCTACTGG - Intronic
1162960035 19:14120263-14120285 TGATCTCGCTTTTCCTCTACAGG - Exonic
926952233 2:18254727-18254749 TGAACTTGCTTTGATTTTACAGG + Intronic
927014161 2:18939339-18939361 TGAAATTGCATTGAATCTACAGG + Intergenic
927161991 2:20272855-20272877 AGATCTTGCACTTCTTCTGCTGG + Intronic
928180276 2:29063727-29063749 AGATCTTGGAATGCTTCCACTGG - Exonic
932640116 2:73437335-73437357 TGTTCTTGGATTGCCTCTCCTGG + Intronic
932653247 2:73582890-73582912 TGATCTGGCAATCCTTCTTCTGG - Intronic
935238125 2:101154856-101154878 TGACCTTGCATTTCTCCTTCTGG - Intronic
936803920 2:116302087-116302109 TGATCTAGCAATTCTACTACTGG + Intergenic
941892886 2:170600009-170600031 AGATCTTGCCTTGCTTCTTATGG + Intronic
942610675 2:177739198-177739220 TGATCTTGCCCTGCTTGTCCTGG + Intronic
944878017 2:203982684-203982706 TGATTTTGCATTGATTCCTCTGG - Intergenic
945230801 2:207587449-207587471 TGATCTAGCAATCCTACTACTGG + Intronic
946061256 2:216943448-216943470 AAAACTTCCATTGCTTCTACTGG - Intergenic
948669533 2:239559128-239559150 TGATTTTTCATTGCTCCTAAAGG - Intergenic
1169150603 20:3286519-3286541 TGGTTTTTCATTGTTTCTACTGG - Intronic
1169153973 20:3313615-3313637 TGGTCTTGCATGGATTTTACAGG - Intronic
1169616070 20:7446817-7446839 TGATCCAGCAATCCTTCTACCGG - Intergenic
1169739389 20:8874756-8874778 TGATTTAGCATTGTTTGTACAGG - Intronic
1170113445 20:12830356-12830378 TAAGCTTTCATTGCATCTACAGG - Intergenic
1170760332 20:19243590-19243612 TGAACTTGCAAAGCTTCTTCTGG + Intronic
1172849821 20:37953507-37953529 TGAATTTGTATTGCTTGTACTGG - Intergenic
1176580788 21:8522699-8522721 TGAAATTGCATTGTTTCTACCGG + Intergenic
1176862621 21:14020172-14020194 TGATCTAGCATTGCTGTTTCTGG + Intergenic
949794225 3:7829072-7829094 TGATCCTGCATTCCCACTACTGG + Intergenic
950963816 3:17132138-17132160 TGATGAAGCATTGCTCCTACAGG + Intergenic
951602095 3:24387891-24387913 TGATCTCACATTGTTTCTCCTGG - Intronic
951847175 3:27097026-27097048 AGATCTTGCATTACTCCTGCTGG - Intergenic
952071360 3:29640605-29640627 TGATCGTGCATAGATTCCACTGG + Intronic
955591754 3:60543698-60543720 AACTCTTGCATTGCTTCTAATGG + Intronic
958519091 3:95160582-95160604 AGAACTTGTATAGCTTCTACAGG - Intergenic
959168152 3:102806881-102806903 TGATATTGCATTGTTTCTTGTGG - Intergenic
959692536 3:109214094-109214116 TGATCTTGCAATTCTACTACAGG - Intergenic
962455545 3:135562194-135562216 TGATCTTACATTTCTTAAACAGG - Intergenic
965130935 3:164700561-164700583 TGACTTTGCATTGCTTATATAGG + Intergenic
965916578 3:173855775-173855797 TGATATCGCCTTGCCTCTACTGG - Intronic
966001004 3:174948607-174948629 TTATCTTTCATGGCTTCTATGGG + Intronic
968249695 3:197197134-197197156 TGATTTTGCAGTCATTCTACTGG - Intronic
970485436 4:16520422-16520444 TGGACTTGCATCGCTTCTAAGGG - Intronic
973073244 4:45891999-45892021 TTATGTTTCATTTCTTCTACTGG + Intergenic
973184116 4:47304157-47304179 TGATCCTGCAATCCGTCTACTGG - Intronic
974194635 4:58556992-58557014 TGTTCTTGCATTCCTTCCCCTGG + Intergenic
975404646 4:73976052-73976074 TGATCTACCATTGCCACTACTGG - Intergenic
975535018 4:75441021-75441043 TGATCCAGCAATCCTTCTACTGG + Intergenic
976018115 4:80585093-80585115 TGATTTTGCAGTGCATCTGCTGG - Intronic
977142743 4:93395191-93395213 TGATCTTATATGGCTTTTACTGG - Intronic
978846928 4:113284443-113284465 TGATCTTACAGTGCTTCTGATGG + Intronic
983721778 4:170863188-170863210 TGATCTAGCAATCCTACTACTGG - Intergenic
987446559 5:18026776-18026798 TGATCTGGCATTTCCACTACTGG - Intergenic
987509735 5:18821600-18821622 TAATCTTGAATTACTTCTTCTGG - Intergenic
987765448 5:22222993-22223015 TGAACTTGAATTGCTTTTAAAGG + Intronic
987903535 5:24046597-24046619 TGACACTGCATTGGTTCTACTGG + Intronic
990921807 5:60976553-60976575 TTTTCTTGCAGTGCTTCTGCTGG + Intronic
990967130 5:61461217-61461239 TGACCTTGCCTGGCTACTACAGG - Intronic
992139365 5:73780430-73780452 TAATCTTTTATTGCTTCTGCAGG - Intronic
993362567 5:86996419-86996441 TGATCTAGCATTCCCACTACTGG - Intergenic
993471989 5:88317444-88317466 TGATCTAGCATTCCCACTACTGG - Intergenic
994749404 5:103720313-103720335 GCATCTGGCATTGCTTCTGCTGG - Intergenic
1003951694 6:11122344-11122366 TGAACTTGCCTTACTTTTACAGG + Intronic
1004106979 6:12674893-12674915 TGATCATGCCATGCCTCTACTGG - Intergenic
1004488195 6:16088194-16088216 TGTTCTTGCATTGCTCCCTCTGG + Intergenic
1005259041 6:24037396-24037418 TGATCTAGCATTCCCACTACTGG - Intergenic
1005953093 6:30645873-30645895 TCATCTCCCATTTCTTCTACAGG + Exonic
1007501405 6:42300614-42300636 TGAGCTTGCTTTCCTTCTTCTGG - Intronic
1008658200 6:53637831-53637853 TGATCTAGCGATGCTTCTTCTGG - Intergenic
1010909902 6:81540979-81541001 TGTTCTTGCTTTGTTGCTACTGG + Intronic
1011119801 6:83939448-83939470 TGATCTTGCTTTGTTTTTATGGG + Intronic
1016499115 6:144699014-144699036 TAATCAGGCATTGCTTCGACAGG - Intronic
1020500254 7:8909699-8909721 AGATCGTGCATTGCTTCTGATGG + Intergenic
1020865327 7:13553575-13553597 TGATCTAGCAATCCTACTACTGG - Intergenic
1020915419 7:14186495-14186517 TGATCTAGCAGTCCCTCTACTGG + Intronic
1025713167 7:63930463-63930485 TGCCCTGGCATTGCATCTACAGG + Intergenic
1028502850 7:91538278-91538300 TGATTTTTCATTGCTTCTAAAGG + Intergenic
1030485539 7:110162323-110162345 TGATGTTACATTGATTCTAGGGG - Intergenic
1033841595 7:145380803-145380825 TGATCCAGCATTGCCACTACTGG - Intergenic
1039649768 8:39328988-39329010 TGATCTTACAATGCTTGTAAAGG + Intergenic
1041033879 8:53766898-53766920 TGATCTTGCCCTGCCTCCACTGG + Intronic
1041868475 8:62605141-62605163 TGTTCTTGCATTTCTTCTGTGGG + Intronic
1042608415 8:70570893-70570915 TGATCTAGCAGTCCTACTACCGG + Intergenic
1045068029 8:98469569-98469591 TGATCTTACTTTACATCTACTGG + Intronic
1046498672 8:115046837-115046859 TGATCCTGCAATCCTGCTACTGG + Intergenic
1048704138 8:137131446-137131468 TGATGCTGCATTGCTTCTCTAGG - Intergenic
1051762837 9:20487204-20487226 TCATCTTTCATTTCTTCTCCTGG + Intronic
1051848667 9:21482321-21482343 TTTTTTTGCATTGCTTCTATAGG - Intergenic
1055090182 9:72356456-72356478 TTATCCTGCGTTGCATCTACAGG - Intronic
1059714118 9:116897232-116897254 TGATCTTGCAGTCCTTCGCCTGG - Intronic
1059971248 9:119670868-119670890 TGATCCAGCATTCCTACTACTGG + Intergenic
1060271778 9:122148215-122148237 TGGACTTGCATTGATTATACTGG - Exonic
1186008287 X:5099735-5099757 TGATCTAGCAATCCTACTACTGG + Intergenic
1186497185 X:10020928-10020950 TGATCTTGCTTTTCTACTGCTGG - Intronic
1187592522 X:20733957-20733979 TGATCTTGGATGGGTTCTGCTGG - Intergenic
1189084971 X:38013391-38013413 TAATCTTTCACTGCTTATACTGG + Intronic
1189179960 X:38994462-38994484 TTATCTTTCATGGCTTCTATGGG + Intergenic
1189600754 X:42622468-42622490 TCAGCTTGCATTGCTTCAAGTGG - Intergenic
1190134083 X:47778719-47778741 TTTTCTTGCATTGCTTCTATTGG + Intergenic
1195152807 X:102090507-102090529 TGATCCAGCAATCCTTCTACTGG - Intergenic
1196219340 X:113093514-113093536 TGATCCAGCAATGCTACTACTGG + Intergenic
1197101715 X:122663718-122663740 CCATGTTGTATTGCTTCTACTGG - Intergenic
1197841623 X:130753873-130753895 TGATCCAGCAGTCCTTCTACTGG - Intronic
1198174525 X:134142391-134142413 TGTTCTTGCATGGGTTTTACTGG - Intergenic
1198547963 X:137713168-137713190 TGATCTTGCAATCCATCCACTGG - Intergenic
1198733262 X:139757245-139757267 GGATTTGGCATTGCTTCTAGTGG - Intronic
1199733235 X:150657939-150657961 TGATGTTGGATAGCTTCTATAGG + Exonic
1199928225 X:152491985-152492007 TGATCTGGCAATTCTGCTACTGG - Intergenic
1201726324 Y:17155734-17155756 TGATCATGGATTGCTTTTCCAGG - Intergenic