ID: 1086606434

View in Genome Browser
Species Human (GRCh38)
Location 11:88701701-88701723
Sequence AAGGTAGAACATCTTGAAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 878
Summary {0: 1, 1: 2, 2: 32, 3: 184, 4: 659}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086606434 Original CRISPR AAGGTAGAACATCTTGAAGC AGG Intronic
900240070 1:1612367-1612389 AAGGTGGGATATCTTGAAGTGGG + Intergenic
900813222 1:4824102-4824124 AAGGTGGGACATCTTGAAGTGGG + Intergenic
901480907 1:9524515-9524537 AAGGTAGAATCACTTGAACCCGG - Intergenic
901800871 1:11707243-11707265 AAGGTAGAACTTCCTGATTCAGG - Intronic
902042164 1:13500551-13500573 AAGGTGGGACAACTTGAAGTGGG - Intronic
902109055 1:14062775-14062797 AAGATAGGACATCATCAAGCAGG + Intergenic
902416026 1:16239844-16239866 AAGACAGGACAGCTTGAAGCAGG - Intergenic
902589518 1:17463623-17463645 AAGTTAGGACAACTCGAAGCAGG + Intergenic
902801714 1:18834402-18834424 AAGACAGAATATCTTGAAGTGGG + Intergenic
902969941 1:20040908-20040930 AAGGCAGGACAACTTGAAGCGGG - Intronic
902997771 1:20240218-20240240 AAGGCAGGACAACTTGAAGCAGG - Intergenic
903309501 1:22443384-22443406 AAGGCAGAACATCTCAAAGCAGG + Intergenic
903393686 1:22983045-22983067 AAGGCAGGACAACTCGAAGCGGG + Intergenic
903596020 1:24495427-24495449 AAGGCAGGACAACTTGAAGCGGG + Intergenic
903618791 1:24682601-24682623 GAGGCAGGACAACTTGAAGCAGG - Intergenic
905838559 1:41152484-41152506 AAGGGAAAACATCTTAAGGCAGG + Intronic
906232930 1:44180893-44180915 AAGGTGGGACAACTCGAAGCGGG + Intergenic
906564441 1:46788513-46788535 AAGGCAGAACAACTTGAAGTGGG + Intronic
906631987 1:47379146-47379168 AAGGTGGGACAACTGGAAGCAGG + Intergenic
907309754 1:53532498-53532520 AAGGCACAACATCTGGAAGTAGG - Intronic
907671816 1:56481049-56481071 CAGGAAGATCATATTGAAGCAGG + Intergenic
909443211 1:75720829-75720851 AAGACAGGACAACTTGAAGCAGG + Intergenic
909717692 1:78728856-78728878 AAGTTAGAACTCCATGAAGCTGG - Intergenic
910121579 1:83796426-83796448 AAGGTGGGACAACTTGAAGAGGG + Intergenic
911407669 1:97463056-97463078 AAGGCAGGACAACTTGAAGCAGG - Intronic
911611255 1:99961122-99961144 AAGGCAGAATATCTTGAAGTGGG + Intergenic
911944885 1:104094496-104094518 AAGGCAGGACAGCTCGAAGCAGG + Intergenic
912563107 1:110564299-110564321 AAGGCGGGACAACTTGAAGCAGG + Intergenic
912627217 1:111215423-111215445 AAGGGGGAACAACTTGAAGTGGG - Intronic
913023508 1:114810759-114810781 AAGGTGGAACAACTAGAAGCAGG - Intergenic
913281105 1:117185834-117185856 AAGGTGGGACAACTTGAAGTGGG - Intronic
913977251 1:143471601-143471623 AAGGGAGAACAGCTTGAACCAGG - Intergenic
914071656 1:144297231-144297253 CAGGGAGAACAGCTTGAACCAGG - Intergenic
914107499 1:144669125-144669147 CAGGGAGAACAGCTTGAACCAGG + Intergenic
915256576 1:154635707-154635729 AAGGTGGGACAATTTGAAGCAGG + Intergenic
915632308 1:157161934-157161956 AAGATGGGACAACTTGAAGCGGG + Intergenic
916623446 1:166526985-166527007 AAGGCAGGACAACTCGAAGCAGG - Intergenic
916675803 1:167063603-167063625 GAGGTACAACATCCTGAATCAGG - Exonic
916998766 1:170331796-170331818 AAGGGAGAACATCGTACAGCAGG - Intergenic
917310679 1:173674605-173674627 AAGGTGGGACAACTCGAAGCAGG + Intergenic
918685309 1:187407880-187407902 AAGGTGGGACAACTTGAAGCAGG - Intergenic
918690168 1:187469336-187469358 AAGGCAGGACAACTTGAAGCAGG - Intergenic
918951240 1:191142442-191142464 AAGGTAGAAGATCATGAAACAGG - Intergenic
918968635 1:191383046-191383068 AAGGCAGGACAACTCGAAGCAGG - Intergenic
918974893 1:191471158-191471180 AATGTGGAACAACTGGAAGCAGG - Intergenic
919596582 1:199571084-199571106 AAGGTAGGACAACTTGAAGGTGG - Intergenic
919789394 1:201280782-201280804 AGGGCAGGACATCTTGAATCAGG - Intergenic
920023862 1:202977591-202977613 AAGGCAGGACAACTTGAAGCAGG + Intergenic
920226500 1:204442852-204442874 ATGGCAGAACAGCATGAAGCAGG + Intronic
920939946 1:210472809-210472831 AAGGCAGGACAACTTGAAGTGGG + Intronic
921022242 1:211246685-211246707 AAGGCAGGACAACTTGAAGTGGG + Intergenic
921343704 1:214159892-214159914 AAGGTTGGACAACTTGAAGTGGG - Intergenic
921901603 1:220457052-220457074 AAGGTGGAACATCTTGAAGGAGG + Intergenic
922008531 1:221556747-221556769 AAGGTAGTATATCTTTGAGCTGG - Intergenic
922076019 1:222245450-222245472 AAGGCAGGACAACTCGAAGCAGG + Intergenic
922528864 1:226327636-226327658 AAGGTGGGATATCTTGAAGTGGG + Intergenic
922758762 1:228111090-228111112 AAGGCAGGACAACTCGAAGCAGG + Intergenic
922813704 1:228433927-228433949 AAGGCAGGACAATTTGAAGCAGG - Intergenic
923066365 1:230520952-230520974 AAGGTGGGACATCTCAAAGCAGG + Intergenic
923252416 1:232189895-232189917 AAGGCACGATATCTTGAAGCAGG + Intergenic
923386610 1:233471449-233471471 GAGGTGGAATATCTTGAAGTGGG - Intergenic
923868707 1:237967628-237967650 AAGGCAGAACAACTTGAAGTGGG + Intergenic
923928086 1:238658822-238658844 AAGACAGGATATCTTGAAGCAGG + Intergenic
924027414 1:239849634-239849656 AAGGTACAAGTTTTTGAAGCAGG + Intronic
924929209 1:248712610-248712632 AAGGCAGGACAACTCGAAGCAGG - Intergenic
924951155 1:248884688-248884710 AAGGTGGGCTATCTTGAAGCAGG + Intergenic
1062953284 10:1521804-1521826 AAGGTGGAAAAACTTGAAGCAGG - Intronic
1063018549 10:2102723-2102745 AGGGTAGAACAACTTGAAGTGGG + Intergenic
1063027966 10:2201744-2201766 AAGGCAGGACATCTCAAAGCAGG + Intergenic
1063102743 10:2964557-2964579 AAGGCAGGACGTCTTGAAGCAGG - Intergenic
1063323467 10:5074112-5074134 AAGGTGGGACAACTTGAAGTGGG - Intronic
1063622049 10:7658645-7658667 AAGGCAGGACATCTCGAAGGTGG + Intronic
1063915886 10:10881874-10881896 AAGATGGAACATATTGAAGATGG - Intergenic
1064098738 10:12444613-12444635 AAGCCAGAACAATTTGAAGCAGG + Intronic
1064804762 10:19118418-19118440 AAGGCAGAACAACTGGAAGAGGG + Intronic
1065131736 10:22628639-22628661 TGGTTAGGACATCTTGAAGCAGG + Intronic
1065378642 10:25067058-25067080 AAGGGGGAACATCTCAAAGCAGG - Intergenic
1065443798 10:25776651-25776673 AGAGTAGGATATCTTGAAGCAGG - Intergenic
1065487368 10:26248221-26248243 AGGGTGGGATATCTTGAAGCAGG + Intronic
1065493851 10:26309172-26309194 AAGGTGGGACAACTGGAAGCAGG + Intergenic
1065609710 10:27460911-27460933 GAGGTGGGATATCTTGAAGCGGG + Intergenic
1065636289 10:27738663-27738685 AAGGCCAAACATCTAGAAGCTGG + Intronic
1065810902 10:29442767-29442789 AAGGTGGGATATCTTGAAGTGGG + Intergenic
1065908508 10:30280869-30280891 GAGGTAGAATATCTTGAAGGGGG + Intergenic
1065982551 10:30914724-30914746 AAGGTAGAACATGAAGAAACTGG - Intronic
1066107162 10:32166271-32166293 GAGGTAGAAGAGCTTGAACCTGG - Intergenic
1066671861 10:37848719-37848741 AACCTAGAACATCTCCAAGCTGG - Intronic
1067399443 10:45957503-45957525 AAGGCAGGATATCTTGAAGTGGG - Intergenic
1067409730 10:46053834-46053856 AAGGTGAGATATCTTGAAGCAGG - Intergenic
1067409767 10:46054182-46054204 AAGGCAGGACAACTTGAAGCAGG - Intergenic
1067538374 10:47133966-47133988 AAGGCAGGACAACTCGAAGCAGG + Intergenic
1067797021 10:49328033-49328055 AAGGCAGGATATCTTGAACCAGG + Intergenic
1067867762 10:49926719-49926741 AAGGCAGGATATCTTGAAGTGGG - Intronic
1068366125 10:56052261-56052283 AAGGCAGAACAACTTGAAGCAGG - Intergenic
1068505334 10:57893256-57893278 AAGGTGGAACAACTCAAAGCTGG + Intergenic
1069013486 10:63400952-63400974 AAGGGAGAACTGCTTGAACCCGG - Intronic
1069383676 10:67865040-67865062 AAGGTGGGATATCTTGAAGTGGG - Intergenic
1069412583 10:68168623-68168645 AAGGCAGAACATCTCAAAGCAGG + Intronic
1070573142 10:77656723-77656745 AAGGTGGGATATCTGGAAGCAGG + Intergenic
1070991500 10:80737030-80737052 AAGGCAGAACAACTCAAAGCAGG - Intergenic
1071055502 10:81504279-81504301 AAGGTAGAATATCTTGAAGTGGG + Intergenic
1071074030 10:81730163-81730185 AAGGCAGGACAACTTGAAGTGGG + Intergenic
1071666055 10:87559663-87559685 AAGGCAGGACATCTTGATGTGGG - Intergenic
1071689079 10:87796459-87796481 AAGGCAGGACAACTTGAAGCAGG - Intronic
1071858765 10:89651320-89651342 GAGGTGGAACATCTAGAAGCAGG + Intergenic
1072213679 10:93270342-93270364 AAGGTGGGACAACTTGAAGTGGG + Intergenic
1072973215 10:100035554-100035576 AAGGTAGGACAACTCGAAGTGGG - Intergenic
1073563069 10:104513421-104513443 CAGGTAGAGCCTCTTGAAGCTGG + Intergenic
1075026910 10:118992030-118992052 AAGGGAGGACAACTCGAAGCGGG + Intergenic
1075226184 10:120631272-120631294 AAGGCAGAACAACTGGAAGTGGG - Intergenic
1075573448 10:123561276-123561298 CAGGTAGAACAGCCTGAGGCAGG - Intergenic
1075852089 10:125597562-125597584 AAGGCAGGATATCTTGAAGTGGG + Intronic
1075975505 10:126690603-126690625 AAGGCAGGACAACTTGAAGTGGG + Intergenic
1076378663 10:130010230-130010252 AAGGCAGGACAACTTGAAGTGGG + Intergenic
1076408460 10:130229633-130229655 AAGGTCGGACATCTTGAAGTGGG + Intergenic
1076764000 10:132621491-132621513 AAGGTGGTACCGCTTGAAGCAGG + Intronic
1077084285 11:740647-740669 AAAGGAGAACAGCTTGAACCTGG + Intergenic
1078936689 11:15957513-15957535 AAGCCACAACATCTTAAAGCAGG - Intergenic
1079643474 11:22834707-22834729 AAGGCAGAACAACTCAAAGCAGG - Intergenic
1080116765 11:28630244-28630266 AAGGAAGAACAATTTCAAGCTGG + Intergenic
1080262449 11:30364303-30364325 AAGATAGAACATCTTGGATGAGG - Intergenic
1080352679 11:31403460-31403482 AAGGCAGGACATCTTGAAGCAGG + Intronic
1080820169 11:35798103-35798125 AAGGCAGGACAACTTGAAGTGGG + Intronic
1080873302 11:36255857-36255879 AAGGTGGGACAACTTGAACCAGG + Intergenic
1081392715 11:42547890-42547912 AAGGTACAACATCTGGAATGAGG - Intergenic
1082689189 11:56278864-56278886 AGGGTGGGACAACTTGAAGCAGG - Intergenic
1082689491 11:56282448-56282470 AAAGTGGAACAACTTGAAGAAGG - Intergenic
1082866324 11:57903029-57903051 AAGGCAGAACAACTTGAAGTGGG + Intergenic
1082942498 11:58722468-58722490 AAGGTGGGACATATTGAAGAAGG + Intronic
1083105903 11:60358532-60358554 AAGGTGGGACAATTTGAAGCAGG + Intronic
1084025962 11:66449693-66449715 AAGGTGGGACAACTGGAAGCTGG - Intronic
1084874720 11:72122741-72122763 AAAGTGGAACAGCTTGAAGTGGG + Intronic
1084933116 11:72572522-72572544 AAGGCAGAACAACTCAAAGCGGG + Intergenic
1085481496 11:76826343-76826365 AAGGTAGGACATCTCTAAGCTGG - Intergenic
1085573898 11:77585383-77585405 AAGGCATGACATCTTGAAGCAGG - Intronic
1085796186 11:79542152-79542174 AAGGTGGGACAACTTGAAGCAGG - Intergenic
1086010337 11:82095369-82095391 TAGGTAGAACATCATGAGCCTGG + Intergenic
1086350186 11:85936398-85936420 AAGGTGGGACAACTTGAAGCAGG + Intergenic
1086493081 11:87375351-87375373 AAGGCGGGACAACTTGAAGCAGG + Intergenic
1086606434 11:88701701-88701723 AAGGTAGAACATCTTGAAGCAGG + Intronic
1086751919 11:90507115-90507137 AAGGCAGGACTTCTTGAAGTAGG + Intergenic
1087042504 11:93815577-93815599 AAGGTGGGACATCTTGAAGTAGG - Intergenic
1087132004 11:94676726-94676748 AAGGTGGAACATCTCAAAGCAGG + Intergenic
1087285332 11:96259205-96259227 TTGGTAGAACATCTTGAAGGGGG - Intronic
1087673500 11:101132209-101132231 AAGATTGAAAATCTTGAAGTGGG + Intergenic
1087900193 11:103631788-103631810 AAGCTGGAACATCTCAAAGCAGG - Intergenic
1088129316 11:106467919-106467941 AAGGTGGGACAACTTGAAGTGGG - Intergenic
1088353222 11:108912952-108912974 AAGGCAGGACAACTTGAAGCAGG - Intronic
1088353259 11:108913265-108913287 AAGGCAGGACAACTCGAAGCAGG + Intronic
1088561840 11:111123124-111123146 AAGGCAGGACATCTCGAAGTGGG - Intergenic
1089403261 11:118177244-118177266 AAAACAGAACATGTTGAAGCAGG + Intergenic
1090058471 11:123443500-123443522 AAGGTTGAACAGTTCGAAGCTGG + Intergenic
1090096931 11:123751648-123751670 AAGGCAGGACAACTTGAAGTGGG + Intergenic
1090099716 11:123781420-123781442 AAGGCAGGACACCTTGAAGCAGG - Intergenic
1090103089 11:123822621-123822643 ACGGTGGAATATCTGGAAGCAGG + Intergenic
1090196741 11:124823050-124823072 AAGGCAGGACAACTTAAAGCTGG + Intergenic
1090583780 11:128188020-128188042 AATGTAGAACATCTGAAAACAGG - Intergenic
1090790296 11:130087409-130087431 AAATTAGAACATCTGGCAGCAGG + Intronic
1090877635 11:130805160-130805182 AAGGTAGGACAACTTGAAGGTGG - Intergenic
1090892471 11:130937172-130937194 AGGGTAAAACATGTTGCAGCTGG + Intergenic
1091109818 11:132955581-132955603 AAGGTAGAAAATGCTGAATCTGG + Intronic
1091176601 11:133563877-133563899 TAAGTAGAAAATGTTGAAGCTGG - Intergenic
1091757799 12:3066565-3066587 AAGGTGGGACAACTTGAAGACGG - Intergenic
1092304138 12:7282223-7282245 AAGGCAGAACAACTGCAAGCAGG - Intergenic
1092645750 12:10570173-10570195 AAGGTGGGACAACTGGAAGCAGG - Intergenic
1093367894 12:18325888-18325910 AAAGTAGAACATCATAAAACTGG - Intronic
1093762375 12:22924761-22924783 AAGGTGGGACAACTGGAAGCAGG - Intergenic
1094421368 12:30274672-30274694 AAGGCAGGACACCTTGAAGCTGG + Intergenic
1094467682 12:30770998-30771020 AAAGCAGGGCATCTTGAAGCAGG - Intergenic
1094468301 12:30778280-30778302 AAAGTGGGACAACTTGAAGCGGG - Intergenic
1094742656 12:33307582-33307604 AAGACAGGACAACTTGAAGCAGG - Intergenic
1094745803 12:33342921-33342943 AAGGCAGGACAACTTGAAGCTGG + Intergenic
1095837601 12:46655502-46655524 AAGGTTGAACAACCTGAACCAGG + Intergenic
1096034093 12:48448962-48448984 AAGGTAGAACAACTTGAAGAGGG + Intergenic
1096205090 12:49714798-49714820 AAGGTAGGGCATCCTTAAGCTGG - Intronic
1096363325 12:51007108-51007130 AAGGTGGGACAACTTGAAGTGGG - Intronic
1097740305 12:63233950-63233972 AAGGTGGGACAACTCGAAGCAGG + Intergenic
1098151097 12:67547455-67547477 CAGGTAGATGATCTGGAAGCAGG - Intergenic
1098674686 12:73274085-73274107 AAAGTGGAACATCTGGAAGTGGG + Intergenic
1098698068 12:73584513-73584535 AAAGCAGGACTTCTTGAAGCAGG - Intergenic
1099200158 12:79667009-79667031 AAGGCAGGACAACTTGAAGAGGG - Intronic
1099308097 12:80983247-80983269 AGGGCAGGACAACTTGAAGCGGG - Intronic
1099620511 12:84997252-84997274 AAGGTGGGACATCTCAAAGCTGG - Intergenic
1100362395 12:93890686-93890708 AAGGTGGGACAACTGGAAGCAGG - Intronic
1101052931 12:100882790-100882812 AAGGGAGAACTGCTTGAACCCGG - Intronic
1101088354 12:101259078-101259100 AAGGTGGGATATCTTGAAGCAGG + Intergenic
1101163491 12:102004622-102004644 AAGGTAGGACAACTGGAAGCAGG - Intronic
1101393729 12:104325334-104325356 CAGGTTGAACAAATTGAAGCAGG + Exonic
1101698673 12:107151369-107151391 AAGACAGAACATCTTGAAGCAGG + Intergenic
1101854537 12:108431297-108431319 AAGGTTGAACAGCTGGAAACAGG + Intergenic
1103095988 12:118132824-118132846 AAGGTAGGATAACTTGAAGTGGG + Intronic
1103213182 12:119181342-119181364 AATGCAGGACAACTTGAAGCAGG + Intronic
1103228043 12:119304860-119304882 AAGGTGGAACAACTCGAAGTGGG + Intergenic
1104530605 12:129566944-129566966 AAGGCGGAACAACTTGAAGCAGG - Intronic
1104641072 12:130467710-130467732 AAGGTGAGACAACTTGAAGCGGG - Intronic
1104706524 12:130951586-130951608 AAGCTAGGACATCTTGAACTGGG - Intergenic
1104764601 12:131318893-131318915 AAGGTAGGACAACTCGAAGTGGG + Intergenic
1104810106 12:131615224-131615246 AAGGTGGGACAACTGGAAGCAGG - Intergenic
1105748346 13:23398575-23398597 AAGGTGGAACAACTCAAAGCAGG + Intronic
1105812800 13:24009536-24009558 AAGATGGGACAACTTGAAGCAGG + Intronic
1105967910 13:25401541-25401563 AAAAAAGAACAGCTTGAAGCAGG - Intronic
1106944372 13:34810402-34810424 GAGGTAGCATATCTTGAAGCGGG - Intergenic
1107020332 13:35744623-35744645 AAGGCAGGATATCTTGAAACAGG - Intergenic
1107709019 13:43134319-43134341 AAGGTGGGACACCTTGAAGCGGG + Intergenic
1108316825 13:49244611-49244633 AAGGTGGGACATCTCGAAGTTGG - Intergenic
1108918982 13:55654234-55654256 AAAGCAGAAAAACTTGAAGCAGG + Intergenic
1109298480 13:60564349-60564371 AAGGCGGGACAACTTGAAGCGGG + Intronic
1109342568 13:61079718-61079740 AAGTTAGGACAACTTGAAGCAGG - Intergenic
1109803569 13:67406765-67406787 AAGGCAGGATATCTTGAAGCAGG - Intergenic
1110094600 13:71501066-71501088 AAGGCAGGACATCTCGAACCAGG - Intronic
1110505711 13:76283888-76283910 AAGGTATAACAGATTGAGGCAGG - Intergenic
1110725416 13:78817033-78817055 AAGGCAGAACATGATGAAGAGGG + Intergenic
1110776175 13:79410826-79410848 GAGGTAGAACTGCTTGAACCTGG - Intergenic
1110888301 13:80666595-80666617 AAGGCAGAACAGCTAGCAGCTGG - Intergenic
1110913212 13:80989789-80989811 AAGGAAGGACATCTAGAAGTGGG + Intergenic
1111122226 13:83867996-83868018 TAGATAGAAAAACTTGAAGCTGG + Intergenic
1111280320 13:86014433-86014455 AAGGTGGGACAACTCGAAGCAGG + Intergenic
1111517333 13:89351670-89351692 AAGGTGGGACAACTTGAAGTGGG - Intergenic
1111564895 13:90001559-90001581 AAGGCAGGACATCTCGATGCAGG + Intergenic
1111895903 13:94141212-94141234 AAGGTAGGATATCTTGAAGCGGG + Intronic
1112079584 13:95954663-95954685 AAGGCAGGAAATCTGGAAGCAGG - Intronic
1112305877 13:98273136-98273158 AAGGTGGGATATCTTGAGGCAGG + Intronic
1112679255 13:101743041-101743063 AAGGCGGGACAACTTGAAGCAGG - Intronic
1112956134 13:105060105-105060127 AAGGCAGAAAATATTGAAACAGG - Intergenic
1113417004 13:110136488-110136510 AAGGGAGGACAACTCGAAGCAGG + Intergenic
1113535669 13:111064499-111064521 AAGGTGGGACAACTTGAAGCAGG - Intergenic
1113727640 13:112617087-112617109 AAGGCAGGAAGTCTTGAAGCAGG - Intergenic
1113748657 13:112763801-112763823 AAGGTGCAACATCTCCAAGCAGG - Intronic
1114565644 14:23630779-23630801 AAGGCAGGACATCTTGAAGTGGG + Intronic
1114826758 14:26090146-26090168 AAGGTAGGACAACTTGATGTTGG - Intergenic
1114912437 14:27218051-27218073 AAGGCAGGACAGCTTGAAGTCGG + Intergenic
1115532919 14:34343510-34343532 GAGGTGGAATATCTTGAAGTGGG - Intronic
1116093221 14:40335244-40335266 AAGGTGGGACAACTTGAAGTGGG + Intergenic
1116128234 14:40817457-40817479 AATGTAGAACACCCTGAAGAAGG - Intergenic
1116558312 14:46342271-46342293 AAGGTAGAATAACTTTAAGAAGG + Intergenic
1117048721 14:51839279-51839301 AAGGTGGGTCAACTTGAAGCAGG + Intronic
1117187408 14:53254558-53254580 AAGGCAGGACAACTTGAAGCGGG + Intergenic
1117411517 14:55455496-55455518 AAGGTGAGACATCTTGAAGCAGG + Intronic
1117416529 14:55501550-55501572 AAGGCAGAACAACTTGAAGTGGG - Intergenic
1117591897 14:57278811-57278833 AGGGTAGAAAATTTTTAAGCAGG + Intronic
1117599662 14:57362321-57362343 AAGGTGGGACATCTTGAAGTAGG + Intergenic
1118186131 14:63540335-63540357 AAGGGAGAACCGCTTGAACCTGG + Intronic
1118198000 14:63646039-63646061 AAGGTGGAATAACTTGAAGTAGG - Intergenic
1118297170 14:64581168-64581190 AAGGCAGGATATTTTGAAGCGGG + Intronic
1118395412 14:65331931-65331953 AAGGTGGGACAACTTGAAGCAGG - Intergenic
1118460796 14:65985357-65985379 AGGGCAGGATATCTTGAAGCAGG - Intronic
1118510879 14:66471804-66471826 AAGGCAGGATAACTTGAAGCAGG - Intergenic
1119090356 14:71775107-71775129 AAGGCAGGACAACTCGAAGCAGG - Intergenic
1119306201 14:73610061-73610083 TAGGTAGAGGATCTGGAAGCAGG + Intergenic
1119789654 14:77338543-77338565 AAGGCAGGACATCTTGAAGATGG - Exonic
1120523150 14:85547865-85547887 AAGGTGGGACAACTTGAAGCAGG + Intronic
1120623015 14:86789293-86789315 AAGGTAGGACAACTTGAAGAAGG - Intergenic
1120769611 14:88364770-88364792 AAGGTGGGACATCTTGAAGGTGG + Intergenic
1120937255 14:89909484-89909506 CAGGGAGAATAGCTTGAAGCCGG + Intronic
1120966669 14:90173769-90173791 AGGGCAGGATATCTTGAAGCAGG + Intronic
1121424955 14:93843795-93843817 AAAGCAGGACAACTTGAAGCAGG + Intergenic
1121425276 14:93846271-93846293 AAGGTGGGACATCCTAAAGCAGG + Intergenic
1122433415 14:101673978-101674000 AAGGCAGGACAACTCGAAGCAGG + Intergenic
1122565545 14:102652733-102652755 AAGATAGAAAATGTTAAAGCAGG - Intronic
1122927304 14:104911058-104911080 AAGGTGGGACAACTTGAAGTGGG - Intergenic
1122950378 14:105041325-105041347 AAGGTGGGACAACTCGAAGCAGG + Intergenic
1123146052 14:106131487-106131509 AAGGCAGGACAACTTGAAGTGGG + Intergenic
1123873394 15:24598714-24598736 AGGGTGGAATATCTTGAAGCAGG + Intergenic
1123876533 15:24629215-24629237 AAGGCAGGACAGCTTGAAGCAGG - Intergenic
1124033146 15:26029632-26029654 AAGGCAGGACAGTTTGAAGCAGG + Intergenic
1124127625 15:26951400-26951422 AAGGTGGGACAACTCGAAGCGGG - Intergenic
1124155346 15:27220223-27220245 AAGGTGGGATATCTTGAAGTGGG + Intronic
1124208881 15:27745922-27745944 AAGGTGGGACAACTTGAAGCAGG - Intergenic
1124789055 15:32709457-32709479 AAGAGAGATCATCTGGAAGCTGG + Intergenic
1125043749 15:35222520-35222542 AGGGTAGGACAACTTGAAGGGGG + Intronic
1128289984 15:66470954-66470976 ACGGCAGGACAACTTGAAGCAGG + Intronic
1128603561 15:69017542-69017564 AAGGTGGGACAGCTGGAAGCAGG - Intronic
1129340760 15:74884899-74884921 AAAGTGGGATATCTTGAAGCAGG + Intergenic
1130122541 15:81063612-81063634 AAGGGAGAACTGCTTGAACCCGG - Intronic
1130432112 15:83859207-83859229 AAGGTGGAATATCTTGAAGTGGG + Intronic
1130742217 15:86612959-86612981 AAGGCAAGACATCTTGAAGCAGG - Intronic
1130889751 15:88123705-88123727 AAGGCAGGACAACTGGAAGCAGG + Intronic
1131193253 15:90334233-90334255 AAGGTGGGACAACTGGAAGCGGG + Intergenic
1131481229 15:92783433-92783455 AAGATGGAATATCTCGAAGCAGG - Intronic
1131638320 15:94261123-94261145 AAGGTGGGACAACTTGAAGCAGG - Intronic
1132407217 15:101551033-101551055 AAGGCAGGACAACTCGAAGCAGG - Intergenic
1132417878 15:101637107-101637129 AAGGCAGGACAGCTCGAAGCAGG + Intronic
1133073131 16:3259970-3259992 GAGGTAGAACTGCTTGAACCTGG + Intergenic
1133467608 16:6042794-6042816 AAGGCAGGACATCTTGAAATGGG + Intronic
1133941914 16:10316476-10316498 AAGGTGGAACAACTTGAAGCAGG - Intergenic
1134592610 16:15467867-15467889 AAGGCAGGACAACTGGAAGCAGG + Intronic
1135204747 16:20474023-20474045 AAGGTGGGGCAACTTGAAGCGGG - Intronic
1135214145 16:20549790-20549812 AAGGTGGGGCAACTTGAAGCGGG + Intronic
1135265035 16:21017506-21017528 AAGGTGGGACAACTTGAAGTGGG - Intronic
1135672875 16:24390103-24390125 AAGGTGGGACTTCTTGAAGTAGG - Intergenic
1136693056 16:32050298-32050320 AAGGCAGGACAACTTGAAGTGGG - Intergenic
1136793550 16:32993524-32993546 AAGGCAGGACAACTTGAAGTGGG - Intergenic
1136876362 16:33860863-33860885 AAGGCAGGACAACTTGAAGTGGG + Intergenic
1137351376 16:47716798-47716820 AAGGTGGAATATCTTGAAGCAGG - Intergenic
1137372248 16:47918446-47918468 AAGGCAGATCATTTTGAAGTGGG + Intergenic
1137373250 16:47928392-47928414 AAGGCAGGATATCTTGAAGCAGG - Intergenic
1138296739 16:55892272-55892294 AAGGTGGGACAATTTGAAGCAGG - Intronic
1138307829 16:55994503-55994525 AAGGGAGAACATGTGGTAGCAGG + Intergenic
1139632571 16:68239481-68239503 AAGGTAGAAAATCTGGAGGAAGG - Intergenic
1140958949 16:79894298-79894320 AAGGTAGTAGATGCTGAAGCTGG - Intergenic
1141781080 16:86161779-86161801 AAGGTGGAACAACTGGAAGTGGG + Intergenic
1141914916 16:87089041-87089063 AAGGTAGAACATCGCAAAGCAGG - Intronic
1203095812 16_KI270728v1_random:1255214-1255236 AAGGCAGGACAACTTGAAGTGGG - Intergenic
1143887936 17:10079613-10079635 AAGGTGGGACAGCTTGAAGCTGG - Intronic
1144189761 17:12833760-12833782 AAGGTGGGACATCTGGAAGCAGG + Intronic
1145285309 17:21501397-21501419 TATGTGGGACATCTTGAAGCAGG - Intergenic
1145392215 17:22464349-22464371 TAGGTGGGACATCTTGAAGCAGG + Intergenic
1148112941 17:45157084-45157106 CAGGGAGAACTGCTTGAAGCCGG + Intergenic
1148949985 17:51302294-51302316 AAGGCAGGACAACTTGAAGCAGG - Intergenic
1148951597 17:51318141-51318163 AAGGCAGGATAACTTGAAGCAGG - Intergenic
1149822634 17:59794314-59794336 AAGGCAGAACTGCTTGAACCCGG - Intronic
1149858734 17:60108169-60108191 GAGGGAGAACAACTTGGAGCTGG - Intergenic
1150192779 17:63260666-63260688 AAGGTAGAATCGCTTGAACCTGG + Intronic
1150956552 17:69866540-69866562 AAGGTAGGACAGCTTAAAGGAGG - Intergenic
1151636081 17:75349089-75349111 AAGGTAGAACAGCTTATAACAGG + Intronic
1151798747 17:76364791-76364813 AAGGTGGGACATCTTGAAGTGGG - Intronic
1152022239 17:77786200-77786222 AAGGCAGGACAACTGGAAGCAGG + Intergenic
1153109963 18:1574216-1574238 AAGGCAGGCCATCTTGAAGCAGG - Intergenic
1153112713 18:1611562-1611584 AAGGTGGGACAACTCGAAGCAGG - Intergenic
1153212048 18:2777894-2777916 AATGTAGAACATTGTGAAACAGG + Exonic
1153404787 18:4725088-4725110 AAGGCAGGACAACTGGAAGCAGG - Intergenic
1153516748 18:5910645-5910667 AAGGCAGAATATCTTGAAGTGGG + Intergenic
1153607948 18:6853814-6853836 AAGGTGGAACAACTTGAAGTAGG - Intronic
1153868137 18:9291993-9292015 AAGGAAGGACAACTCGAAGCAGG - Intergenic
1155173524 18:23284490-23284512 AAGGTAGGACAACTCGGAGCAGG - Intronic
1155333251 18:24739243-24739265 ATGCTAGAATATCTTAAAGCAGG - Intergenic
1155598638 18:27517317-27517339 AGGGCAGGATATCTTGAAGCGGG - Intergenic
1155636376 18:27960370-27960392 CAGGAAGAACATCTTGTAGATGG + Intronic
1155638615 18:27985188-27985210 AAGATAAAATTTCTTGAAGCTGG - Exonic
1155749102 18:29398131-29398153 TAGGTAGAAAAACTTGAAGCTGG + Intergenic
1155943543 18:31823653-31823675 AAGGCAGAACATCTTGAAGTGGG + Intergenic
1155954673 18:31947011-31947033 AAGGTGGGACAACTTGAAGAGGG - Intronic
1155955348 18:31952193-31952215 AAGGCAGAACAACTCAAAGCAGG - Intronic
1156300405 18:35831500-35831522 AAGGTGGGACAACTTGAAGCAGG + Intergenic
1156942090 18:42780238-42780260 AAGGCAGGACATCTGGAAGCAGG + Intronic
1157018138 18:43744316-43744338 AAGGTGGCACAACTTGAAGTGGG + Intergenic
1157428732 18:47605790-47605812 AAGGTAGGACAACTCAAAGCTGG + Intergenic
1157990941 18:52495459-52495481 AAGGAAGAACTTCATAAAGCTGG - Intronic
1158006299 18:52675438-52675460 AAGGTGGAACAACTTGAAGTTGG - Intronic
1158645933 18:59247099-59247121 AAGGCAGGACAGCTGGAAGCGGG - Intergenic
1158849467 18:61480480-61480502 AAGGTGGGACAACTCGAAGCAGG + Intronic
1159046938 18:63377711-63377733 AAGGTGGAACAACTGGAAACTGG - Intergenic
1159163176 18:64670570-64670592 AAGGAAGAATATCTGGAAGAGGG + Intergenic
1160475458 18:79181385-79181407 AAGGCTGAAAATCTTGAAACTGG - Intronic
1162699065 19:12500150-12500172 AAGGTAGAATATCTTGAAGCGGG + Intronic
1163280424 19:16313163-16313185 AAGGCAGAAAATCTTGACTCTGG - Intergenic
1164137826 19:22429226-22429248 AAGGTGGGACAACGTGAAGCTGG + Intronic
1164430528 19:28184597-28184619 AAGGTGGGACATCTTCTAGCAGG - Intergenic
1164524784 19:29005343-29005365 AAGGTGGAATATCTTGAAGCAGG + Intergenic
1166207971 19:41285318-41285340 GAGGTAGAATAGCTTGAACCGGG - Intronic
1166362177 19:42257416-42257438 AAGGTAGAATCGCTTGAACCCGG + Intergenic
1166654803 19:44603067-44603089 AAGGTGGGACAACTTGAAGTGGG - Intergenic
1167799932 19:51733791-51733813 AAGGCAGAATATCTTGAAGAGGG + Intergenic
1168396524 19:56053300-56053322 AAGGGAGAATAGCTTGAACCTGG + Intronic
924965736 2:74853-74875 AAGGCAGGACAAATTGAAGCAGG - Intergenic
925124919 2:1447385-1447407 AAGGCAGGACATCTGGAAGCGGG - Intronic
925173317 2:1766101-1766123 AAGGTGGGACAACTGGAAGCAGG + Intergenic
925268585 2:2585231-2585253 AAGGCAGGATATCTTGAAGTAGG - Intergenic
925490249 2:4383472-4383494 AAGGTGGAACAACTCGAAGCAGG - Intergenic
925976309 2:9144481-9144503 AAGGCAGGACAACTTGAAGTTGG + Intergenic
927559768 2:24061803-24061825 AAGAAAGAACAGCTTGAACCAGG - Intronic
927892813 2:26763039-26763061 AAGGTAGGACAACTCAAAGCCGG - Intergenic
927950698 2:27166747-27166769 AAGTTGGGACATCTTGAAGTGGG - Intergenic
928243030 2:29602987-29603009 AAGGCAGGACAACTTGAAGTGGG + Intronic
928350475 2:30548410-30548432 AAGGTGGGACAACTTAAAGCAGG + Intronic
928671615 2:33608936-33608958 AAGGTGGGACAACTTGAAGGGGG - Intergenic
928682082 2:33712996-33713018 AAGGTGGGACAACTTGAAGAGGG - Intergenic
929211871 2:39366245-39366267 AGGGTGGGACAGCTTGAAGCAGG + Intronic
930164210 2:48187830-48187852 AAGGCAGAACAACTGGAAGCGGG - Intergenic
930495123 2:52131611-52131633 AAGGCAGGACAACTTGAAGCAGG - Intergenic
932668884 2:73719665-73719687 AAGGTGGGATATCTTGAAGTCGG + Intergenic
933262094 2:80142152-80142174 AAAGTGGGACATCTTGAGGCAGG - Intronic
933345434 2:81078969-81078991 AAGGTAGGACAACTTGAAGAGGG - Intergenic
933432405 2:82199854-82199876 AAGGCAGAACATCTTGAAGTGGG - Intergenic
933645403 2:84809010-84809032 GAGTTAGAATTTCTTGAAGCAGG + Intronic
934108250 2:88716247-88716269 AAGGCAGGACAACTTGAGGCGGG - Intronic
934131307 2:88951836-88951858 AAGGTGGGATATCTTGAAGCAGG - Intergenic
934133140 2:88969096-88969118 AAGGTGGGATATCTTGAAGCAGG - Intergenic
934140610 2:89043777-89043799 AAGGTGGGATAGCTTGAAGCAGG - Intergenic
934141228 2:89049876-89049898 AAGGTGGGATAGCTTGAAGCAGG - Intergenic
934181953 2:89632581-89632603 CAGGGAGAACAGCTTGAACCAGG - Intergenic
934187524 2:89760318-89760340 GAGGCAGAACTGCTTGAAGCTGG - Intergenic
934222336 2:90096499-90096521 AAGGTAGGATAGCTTGAAGTAGG + Intergenic
934228012 2:90150669-90150691 AAGGTGGGATAGCTTGAAGCAGG + Intergenic
934228626 2:90156765-90156787 AAGGTGGGATAGCTTGAAGCAGG + Intergenic
934233278 2:90206287-90206309 AAGGTGGGATATCTTGAAGCAGG + Intergenic
934292257 2:91706806-91706828 CAGGGAGAACAGCTTGAACCAGG - Intergenic
934537290 2:95145660-95145682 AAGGCAGGACAACTTGAAGCTGG - Intronic
935122273 2:100193362-100193384 AAGGTGGGATATCTTGAAGGTGG + Intergenic
935965197 2:108465946-108465968 GAGGGAGAACAGCTTGAACCTGG - Intronic
936477171 2:112849330-112849352 AAGGCAGAACAACTTGAAGCAGG - Intergenic
936478484 2:112863309-112863331 AAGGCAGGACAACTTGAAGCAGG - Intergenic
936860556 2:117013061-117013083 AAGGCAGGACATCTTGGAGCAGG + Intergenic
937575759 2:123419526-123419548 AAGGTATGATATCTTGAAGAAGG + Intergenic
937780775 2:125834655-125834677 AAGGTGGGACATCTTGAGGCAGG + Intergenic
937891369 2:126941458-126941480 AAGGCAGGACACCTTGAGGCTGG - Intergenic
937892657 2:126950528-126950550 AAGGTAGGGTATCTTGAAGTGGG - Intergenic
937925396 2:127163893-127163915 AAGGTGGGACAACTTGAAGGAGG - Intergenic
938035965 2:128035219-128035241 AAGGCAGAAAAACTCGAAGCAGG + Intergenic
938058099 2:128232352-128232374 AAGGCAGAATAGCTTGAACCCGG - Intergenic
938238777 2:129726931-129726953 AAGATGGGACATCTTGAAGTGGG - Intergenic
938781892 2:134592024-134592046 AAGGCAGGACAGTTTGAAGCAGG + Intronic
938973217 2:136451025-136451047 AAGGTGAAACATCTCGAAGCAGG + Intergenic
939154996 2:138514292-138514314 AAGGCAGGACAACTCGAAGCTGG + Intronic
939744888 2:145956610-145956632 AAGGTAGGACAATTCGAAGCAGG + Intergenic
940132315 2:150396303-150396325 AATGTAAAACATCTTGAGCCGGG + Intergenic
940144021 2:150525976-150525998 AAGGTGGGACAACTTGAAGCTGG + Intronic
940172905 2:150848144-150848166 AAGGCAGGATGTCTTGAAGCAGG + Intergenic
940428973 2:153565264-153565286 AAGGAAAAACATGTTGAGGCAGG + Intergenic
940969609 2:159881438-159881460 CAGGTAGAACATCTGCAGGCTGG + Intronic
941405569 2:165083524-165083546 AAGGCAGGACAACTCGAAGCAGG - Intergenic
941863613 2:170310711-170310733 AAGGCAGTACAACTTGAAGGTGG + Intronic
942098317 2:172554869-172554891 AAGGTGGGACAACTTGAAGCAGG - Intergenic
942172883 2:173304698-173304720 AAGGTAGGACAACTTGAAGCAGG + Intergenic
942294036 2:174500269-174500291 AAGGCAGAACATCTTGAATGAGG + Intergenic
942605096 2:177682242-177682264 AAGGCGGAACATCTTGAAGTGGG - Intronic
942625385 2:177894872-177894894 AGGGCAGGATATCTTGAAGCAGG - Intronic
942689689 2:178572375-178572397 AAGGTAGACCAGCTTCAAGAAGG - Exonic
943256366 2:185598542-185598564 AAGGCAGGACAACTTGAAGCTGG + Intergenic
943691028 2:190869742-190869764 AAGGTGGGACATCTTGAAATGGG + Intergenic
943802617 2:192081069-192081091 AAGTAAGAACATCTTGTAACAGG + Intronic
944301480 2:198129471-198129493 AAGGCAGAACAACTCGAAGCAGG - Intronic
945529474 2:210932540-210932562 AAGGCAGGAAATCTTGAACCAGG + Intergenic
945931495 2:215859881-215859903 AAGGTGGAAGAGCATGAAGCTGG + Intergenic
946931148 2:224672823-224672845 AAACTATAACATCTTGAGGCAGG - Intergenic
947226086 2:227841665-227841687 AAGGTGGGATATCTTGAAGAGGG + Intergenic
947996335 2:234530932-234530954 AAGGTGGGACAGCTGGAAGCAGG - Intergenic
948016371 2:234694085-234694107 AAGGCAGAACAACTCAAAGCAGG - Intergenic
948106973 2:235422006-235422028 AAACTAGAACATCTTCAAGGTGG + Intergenic
1169443439 20:5652124-5652146 AAGGTAGAACCACTCAAAGCAGG - Intergenic
1169619379 20:7488038-7488060 AGGGTAGAATGTCTTGAAGTAGG - Intergenic
1170544462 20:17423250-17423272 AAGGCAGGACATCTTGAAGCAGG + Intronic
1170724204 20:18911582-18911604 AAGGCAGGACAACTTGAAGCAGG - Intergenic
1170725056 20:18918803-18918825 AAGGCAGGACATCTTGAAGCAGG + Intergenic
1170947986 20:20909219-20909241 GAGGCAGGACATCTCGAAGCAGG - Intergenic
1171331234 20:24340377-24340399 AAGGGAGAACAACTTGGAGGTGG - Intergenic
1171342858 20:24444317-24444339 AAGGCAGAACATCTCCAAGTGGG + Intergenic
1171475324 20:25404306-25404328 AAGGTGGGATATCTTGAAGCAGG - Intergenic
1172644969 20:36463215-36463237 AGGTTACAACACCTTGAAGCTGG - Intronic
1172934590 20:38610608-38610630 AAGGCGGCATATCTTGAAGCCGG + Intronic
1173377395 20:42498847-42498869 AAGGTGGGACATCTCAAAGCCGG - Intronic
1174095428 20:48085392-48085414 AAGGTGGGACAACTCGAAGCGGG - Intergenic
1174149575 20:48476605-48476627 AAGTTTGAGCATCTTGGAGCTGG + Intergenic
1174333171 20:49837181-49837203 AAGGTGGGACAACTAGAAGCAGG - Intronic
1175033023 20:55974058-55974080 AGGGTAGGATATCTTGAAGTGGG - Intergenic
1175648564 20:60696779-60696801 AAGGTGGGACAACTTGAAGGAGG + Intergenic
1175679035 20:60971472-60971494 AAGGTAGTCAATCTAGAAGCTGG - Intergenic
1175782011 20:61688908-61688930 AAAGGAGAAGATCTTGAAGGAGG - Intronic
1176291533 21:5047928-5047950 AAGGCAGGAGATCTTGGAGCAGG - Intergenic
1176524731 21:7857551-7857573 AAGGTGGAACATCTTGAAGTGGG + Intergenic
1176730526 21:10490639-10490661 CAGGGAGAACAGCTTGAACCAGG + Intergenic
1176915231 21:14617651-14617673 AAGGTAGACTATTTTGAAGACGG - Intronic
1177197974 21:17922983-17923005 AAGGTGGGACAACTTCAAGCAGG + Intronic
1177217566 21:18150070-18150092 AAGGTGGGACAACTTGAAGCAGG + Intronic
1177416061 21:20794776-20794798 AGGGCAGGATATCTTGAAGCAGG - Intergenic
1177589137 21:23139293-23139315 AAGGCAGGACAACTTGAAGTGGG + Intergenic
1178094550 21:29199475-29199497 AAGGCAGGACAACTTGAAGTTGG - Intronic
1178190996 21:30280965-30280987 GAGGTAGAATCTCTTGAACCCGG - Intergenic
1178658751 21:34487564-34487586 AAGGTGGAACATCTTGAAGTGGG + Intergenic
1178705476 21:34869211-34869233 AAGGAAGAACATCATCAAGAGGG + Intronic
1178829040 21:36039931-36039953 CAGGGAGAACCTCTTGAAGATGG - Intronic
1179620160 21:42609089-42609111 AAGGTGGAACAACTGGAAGGTGG - Intergenic
1179865722 21:44215713-44215735 AAGGCAGGAGATCTTGGAGCAGG + Intergenic
1181358546 22:22317588-22317610 AAGGCAGGACAACTTGAAGTGGG + Intergenic
1182453905 22:30437579-30437601 AAGGCAGGACAACTTGAAGTGGG + Intergenic
1182801132 22:33032821-33032843 AAAGCAGTACATCTTGAAGCTGG - Intronic
1183430850 22:37764880-37764902 GAGGTAGAACCTTTTGAGGCAGG + Intronic
1183450282 22:37890417-37890439 GAGGTAGAATAGCTTGAACCTGG - Intergenic
1183888265 22:40903258-40903280 AAGGTAGAATATAGAGAAGCAGG - Intronic
1184746164 22:46457512-46457534 AAGGCTGAACATCTTGGAGGGGG - Intronic
1184986150 22:48136754-48136776 AAGATGGGACAACTTGAAGCAGG + Intergenic
949823433 3:8139530-8139552 AAGGTGGGATATCTTGAGGCAGG + Intergenic
949927628 3:9054480-9054502 AAGGTGGGACAACTGGAAGCAGG - Intronic
950228487 3:11255685-11255707 AAGGCAGGACAACTGGAAGCCGG + Intronic
950392872 3:12710417-12710439 AAGGTGGAACATCTGGGATCAGG - Intergenic
950920531 3:16689656-16689678 AAGGCAGGATATCTTGATGCAGG - Intergenic
950920587 3:16690121-16690143 AAGGTAGGACATCTTGAAGTAGG + Intergenic
950977468 3:17263270-17263292 GAGGTAGAACAGCTTGAGTCTGG + Intronic
951472143 3:23068052-23068074 AAGGCAGGATATCTTAAAGCAGG + Intergenic
951788279 3:26449173-26449195 AAGGCAAGATATCTTGAAGCAGG - Intergenic
952033733 3:29175276-29175298 AAGGTGGAACAACTCGAAGTGGG + Intergenic
952043305 3:29285924-29285946 AATGTAGAAAATCTTGCAGAGGG + Intronic
952162273 3:30705933-30705955 AATGTGGGACATCTTGAAGCAGG - Intergenic
952202276 3:31142892-31142914 AAGGTGGGACATCTGGAAGCAGG - Intergenic
953092802 3:39746504-39746526 ATGGCAGGACATCTTGAAGCAGG + Intergenic
953165823 3:40464061-40464083 GAGGCAGAACAACTTGAACCTGG - Intergenic
953320212 3:41964467-41964489 AAGGTGGGACAACTCGAAGCTGG - Intergenic
953454003 3:43027983-43028005 AAGGAAGGACAACTGGAAGCAGG + Intronic
954587949 3:51753176-51753198 AAGGTGGGACAACTTGAAGTGGG + Intergenic
954651495 3:52166852-52166874 AAGGTGGGACAACTCGAAGCAGG - Intergenic
954961682 3:54571077-54571099 AAGGCAGGACAGCTCGAAGCAGG + Intronic
956307768 3:67845225-67845247 AAGGTGGGACAACTCGAAGCGGG + Intergenic
956815723 3:72906450-72906472 AAGGTAATACATAGTGAAGCAGG - Intronic
957911546 3:86625093-86625115 AAGGCAGGACAACTTGAAGAGGG + Intergenic
957983495 3:87542790-87542812 AAGGCAGAACAACTCAAAGCAGG + Intergenic
957999016 3:87728174-87728196 AAGGTGGGACAACTGGAAGCGGG - Intergenic
958038179 3:88194270-88194292 AAAGTGGGACAACTTGAAGCGGG - Intergenic
959477145 3:106824676-106824698 ATGGTGGGATATCTTGAAGCAGG - Intergenic
959487017 3:106938574-106938596 AAGGCAGGATATCTTGAAGTGGG + Intergenic
959897419 3:111620189-111620211 ATGCTAGAACATATTAAAGCAGG - Intronic
960228201 3:115192338-115192360 AAGGCAGGACAACTTGAAGTGGG - Intergenic
960239346 3:115322280-115322302 AAGGCAGAACTTCCTGAATCAGG + Intergenic
960317038 3:116190882-116190904 AGAGTAGCACATGTTGAAGCTGG - Intronic
961182818 3:124889354-124889376 AAGGCAGGACAACTTGAAGTGGG - Intronic
961411729 3:126727126-126727148 AAGGTAGAAGATGTGGGAGCAGG - Exonic
961800698 3:129446586-129446608 AAGATGGAACAACTTGAAGCAGG - Intronic
962015909 3:131440728-131440750 AAGGTAGGATATCTTGAAGTGGG + Intergenic
962120127 3:132552546-132552568 AAGGTGGGACAACTTGAAGCGGG - Intergenic
962467758 3:135676040-135676062 AAGGTGGGACAACTTGAAGTGGG - Intergenic
962688041 3:137866390-137866412 AAGGCAGGATATCTTGAAGTGGG - Intergenic
962949387 3:140204091-140204113 CAGGTAGAAAATGGTGAAGCAGG - Intronic
964478423 3:157118395-157118417 AAGGCGGCACAACTTGAAGCTGG + Intergenic
964856396 3:161150588-161150610 AGGGTAGAATATCTTGGAGTGGG + Intronic
965256255 3:166416956-166416978 AAGGTGGAATAACTTGAAGGAGG + Intergenic
965557384 3:170032469-170032491 ACGGCAGGACAACTTGAAGCAGG + Intergenic
965843884 3:172939071-172939093 AGGGCAGGATATCTTGAAGCGGG - Intronic
965871132 3:173266724-173266746 AAGGTGGGATATCTTGAAGTAGG + Intergenic
966036319 3:175421243-175421265 AAGGTAGAGCATCTATAAGTTGG - Intronic
966962396 3:184953350-184953372 AAGGTGGGATATCTTGAAGTGGG + Intronic
967306398 3:188063760-188063782 AAAGCAGGACATTTTGAAGCAGG + Intergenic
967494783 3:190130529-190130551 AAATTAGAACATCTTGGATCCGG + Intergenic
968295622 3:197574517-197574539 AAGGCAGAATAACTTGAAGCAGG + Intergenic
969079158 4:4604909-4604931 AAGGCAGAACAACTCAAAGCAGG - Intergenic
969346375 4:6573133-6573155 AAGGTGGGACATCTTGAAGTGGG - Intergenic
969368354 4:6713886-6713908 AAGGCAGGACAACTTGAAGCGGG + Intergenic
969550139 4:7860444-7860466 CAGGTTGAACATCCTGAATCTGG - Intronic
969655157 4:8492826-8492848 AAGGTGGGACAACTCGAAGCAGG - Intronic
969661921 4:8535291-8535313 AAGGTGGGACATCTTGAAGTAGG - Intergenic
969918202 4:10510843-10510865 AAGGTGGGACAGCTTGAAGTGGG - Intronic
970854639 4:20637823-20637845 AAGGTAGGACAACTCGAAGCGGG + Intergenic
970971328 4:21987747-21987769 AAGGTGGGACAACTTGAAGCAGG - Intergenic
971117306 4:23663583-23663605 AAGGCGGGACATCTTGAAGCAGG + Intergenic
971692691 4:29858158-29858180 AAGGCAGGACAACTGGAAGCAGG - Intergenic
972055126 4:34792464-34792486 AAGGTGGGACAACTTGAAGCAGG + Intergenic
972170931 4:36344406-36344428 AAGGTAGGACAACTCAAAGCAGG + Exonic
972322916 4:37989363-37989385 AAGGTGGGACAACTTGAAGGTGG - Intronic
972980951 4:44700493-44700515 AAGGCAGGACAACTTGAAGAGGG - Exonic
973193557 4:47414372-47414394 AAGGAGGGACAACTTGAAGCAGG + Intronic
973281745 4:48365371-48365393 GAGGGAGAACAGCTTGAACCTGG + Intronic
974492903 4:62589596-62589618 AAGGCAGGACAATTTGAAGCTGG + Intergenic
974882912 4:67781346-67781368 AGGGCAGGACAACTTGAAGCAGG - Intergenic
975029077 4:69591333-69591355 AAGGTGGGACAACTTGAAGTGGG + Intronic
975224478 4:71855867-71855889 AAGGCAGGACAACTTGAAGTGGG + Intergenic
975707350 4:77124190-77124212 AAGGTAGGACAACTTGAAGTGGG - Intergenic
976507682 4:85868131-85868153 AAGGCAGAACATCTGGAAGCAGG + Intronic
976663688 4:87567086-87567108 AAGGTACAGCTTCCTGAAGCTGG + Intergenic
976988442 4:91331511-91331533 AAGGTCAAATGTCTTGAAGCAGG - Intronic
977411494 4:96671961-96671983 AAGGTAGGACAACTGGAAGTGGG + Intergenic
977486302 4:97650475-97650497 AAGGCAAGACAACTTGAAGCAGG + Intronic
977608931 4:99012867-99012889 AAGGTGGGACAACTTGAAGTGGG + Intronic
977643050 4:99378863-99378885 AAGGCAGGACAACTTGAAGCAGG + Intergenic
978423065 4:108554500-108554522 AAGGCAGGACAACTTGAAGTGGG - Intergenic
979397194 4:120202843-120202865 AGGGTGGGATATCTTGAAGCTGG + Intergenic
979479874 4:121204361-121204383 AAGGCAGGACAACTTGAAGTGGG - Intronic
979750966 4:124278180-124278202 AAGGTGGGACATCTCAAAGCAGG + Intergenic
980071415 4:128246399-128246421 AAGGCAGGACAACTTGAAGCAGG + Intergenic
981022269 4:140041525-140041547 AAGGCAGACCAGGTTGAAGCTGG + Intronic
981070804 4:140536062-140536084 ATGGTAAGACATCTTGAAGAAGG - Intronic
981243109 4:142502375-142502397 AGGGTGGGACATCTTGAAGCAGG - Intronic
981427312 4:144618335-144618357 AAGGCAGGATATCTTGAAGCAGG - Intergenic
981903248 4:149890989-149891011 AAGGCAGGTCAACTTGAAGCTGG + Intergenic
982787895 4:159557716-159557738 AAGGTGGGACATCTTGAAAGGGG + Intergenic
982793422 4:159618220-159618242 AAGGAAGGACAACTTGAATCAGG + Intergenic
982915262 4:161201370-161201392 AAGGCAGGACAACTGGAAGCAGG + Intergenic
983139556 4:164132940-164132962 CAGCAAGAACATCTTCAAGCTGG + Intronic
983495507 4:168438253-168438275 AAGGCAGGATATCTTGAAGCAGG - Intronic
983705552 4:170654185-170654207 AAGGTGGGACAACTTGAAGCAGG - Intergenic
983778931 4:171643900-171643922 AAGGCAGGACAACTTGAAGTGGG - Intergenic
984170376 4:176351346-176351368 AAGGTGGGACAACTTGAAGTGGG + Intergenic
984399105 4:179238781-179238803 AAGGCAGGATAACTTGAAGCAGG + Intergenic
984606114 4:181787749-181787771 AAGGCAGGACATCTTGAAACAGG - Intergenic
984706582 4:182851541-182851563 AACGTGGAACATCTCAAAGCAGG + Intergenic
985285147 4:188329589-188329611 AAGGTGCGACAACTTGAAGCAGG + Intergenic
986158451 5:5200267-5200289 AAGGTAGGAACTCTTTAAGCTGG + Exonic
987474089 5:18369342-18369364 AAGGCAGGACAACTTGAAGTGGG - Intergenic
988040559 5:25883873-25883895 AAGGTGGGCCATCTTGAAGTGGG - Intergenic
988140087 5:27226224-27226246 AGTGCAGGACATCTTGAAGCAGG + Intergenic
988247138 5:28701223-28701245 AAGGTAGAACATCTCTTATCTGG - Intergenic
988572601 5:32384933-32384955 AATGCAGAACATCCTAAAGCAGG - Intronic
988927494 5:36004269-36004291 AAGGCAGGACAACTTGAGGCAGG - Intergenic
989183402 5:38600170-38600192 AAGGTGGGACAACTGGAAGCAGG - Intronic
989320968 5:40133169-40133191 AAGGCAGAACAACTGGAAGTGGG + Intergenic
989333520 5:40287919-40287941 AATGGTGAACACCTTGAAGCAGG - Intergenic
989463348 5:41726289-41726311 AAGGCAGGACATCTTGAAGCAGG - Intergenic
989564074 5:42884067-42884089 AAGGCAGGACAATTTGAAGCAGG - Intronic
989742064 5:44785029-44785051 AAGGTGGGCCAACTTGAAGCAGG - Intergenic
990006978 5:50955066-50955088 AAGGTGGAACAACTTGAAGCGGG - Intergenic
990614177 5:57490269-57490291 AAGGCAGGACAACTGGAAGCGGG + Intergenic
990915693 5:60902227-60902249 AAGGTGAAACACCTTGAAGGTGG + Intronic
991423506 5:66465989-66466011 AAGGTGGGAAAACTTGAAGCAGG + Intergenic
991635609 5:68701774-68701796 AAGGAAGAAAATCATGAGGCTGG - Intergenic
992446622 5:76839869-76839891 AAGGCAGGACAACTTGAAGCGGG - Intergenic
992583693 5:78209504-78209526 AAGGCAGGACAACTTGAAGACGG - Intronic
992588851 5:78272211-78272233 AAGGCATGACAGCTTGAAGCAGG - Intronic
993527630 5:88985866-88985888 AAGTTAGAACTTCTTGTACCTGG + Intergenic
993636718 5:90353143-90353165 AAGGGAGGATATCTTGAAGCAGG + Intergenic
993652832 5:90542821-90542843 AAGGTGGGACAACTTGAAGTGGG + Intronic
994341287 5:98631601-98631623 AAGGAAGAACATCTAGAATTTGG + Intergenic
994776269 5:104038719-104038741 AAGGCAGGACAACTTGAAGCAGG - Intergenic
994835309 5:104844215-104844237 AAGGTGGGATATCTTAAAGCAGG - Intergenic
995109377 5:108411952-108411974 AGGGCAGGATATCTTGAAGCAGG + Intergenic
995127874 5:108597896-108597918 AAGGCAGGACAACTGGAAGCAGG + Intergenic
995657000 5:114437756-114437778 AAGGTAGAAAATCATGAGTCTGG + Intronic
996236339 5:121135508-121135530 AGGGTAGGATATCCTGAAGCAGG + Intergenic
996434459 5:123419448-123419470 GAGGCAGAACAGCTTGAACCCGG + Intronic
996808176 5:127481727-127481749 AAGGTGGGACAACTTGAAGGTGG + Intergenic
996914943 5:128701328-128701350 AAGGTGGGACAACTTGAAGCTGG + Intronic
997158588 5:131583586-131583608 AAGGCAGGATGTCTTGAAGCAGG - Intronic
997425031 5:133797243-133797265 AAGGCAGGATGTCTTGAAGCAGG + Intergenic
997458723 5:134037597-134037619 AAGGTGGGATATCTTGAAGCAGG - Intergenic
997497245 5:134339059-134339081 AAGGGAGAACTGCTTGAACCCGG + Intronic
997558433 5:134821984-134822006 AAGGGAGAACTCCTTGAACCTGG - Intronic
999258577 5:150223378-150223400 AAGGTAGAACTTCTAGATGATGG + Intronic
999289894 5:150417560-150417582 AAGGTGGGACATCTTGAAGTGGG - Intergenic
999334893 5:150706990-150707012 AAGGTGGGACATCTCAAAGCTGG + Intergenic
999545682 5:152626022-152626044 AAGGTGGGACAACTCGAAGCAGG - Intergenic
999548786 5:152660966-152660988 AAGCTATAAAATCATGAAGCTGG + Intergenic
999726406 5:154441977-154441999 AAGGCAGGACAACTTGATGCTGG - Intergenic
999819355 5:155210009-155210031 AAGGCAGGATGTCTTGAAGCAGG + Intergenic
1000823921 5:166020376-166020398 AAGGTGGGACAACTTGAAGTGGG + Intergenic
1001282603 5:170397869-170397891 AAGGTGGGACAACTTGAAGAGGG + Intronic
1001339256 5:170828494-170828516 AAGGTGGGACATCTTGAAGCAGG - Intergenic
1001975451 5:175994957-175994979 AAAGTAAAACACCTTGCAGCAGG - Intronic
1002241982 5:177848813-177848835 AAAGTAAAACACCTTGCAGCAGG + Intergenic
1002347557 5:178558283-178558305 AAATGATAACATCTTGAAGCGGG - Intronic
1002371858 5:178761241-178761263 AAGGTGGGACATCTCAAAGCGGG + Intergenic
1002407150 5:179043978-179044000 CAGGCAGGACATCTTGAAGGTGG + Intergenic
1002870005 6:1158055-1158077 GAGGCAGGACATCTTGAAGCAGG - Intergenic
1002994581 6:2270832-2270854 AAGGCAGGACATCTTGAAGCAGG + Intergenic
1003067177 6:2913691-2913713 AAGGCAGGACAACTGGAAGCAGG + Intergenic
1003297833 6:4849249-4849271 GAGGAAAAACATCTTGAAGGGGG + Intronic
1003321387 6:5055161-5055183 AAGGCAGGACTTCTCGAAGCAGG - Intergenic
1003674895 6:8193858-8193880 AAGGTAGAACAAATAGAAGTGGG - Intergenic
1005322586 6:24669295-24669317 AAGGCGGGACAACTTGAAGCGGG + Intronic
1005324272 6:24683680-24683702 AAGGTAGGACAACTCGAAGTAGG + Intronic
1005370677 6:25129156-25129178 AAAGCAGGACAACTTGAAGCAGG - Intergenic
1005788093 6:29267695-29267717 AATGTAGAACATCTAAAACCAGG + Intergenic
1006051106 6:31345110-31345132 AAGGTAGAATATCCTGATGAGGG + Intronic
1006491210 6:34390042-34390064 CAGGGAGAACAGCTTGAACCCGG + Intronic
1006732238 6:36245028-36245050 AGGGTGGGACATCTCGAAGCGGG + Intronic
1006861725 6:37176073-37176095 GAGGTAGAACTGCTTGAACCCGG - Intergenic
1007215003 6:40230042-40230064 AAGGCAGGACATCTTAACGCAGG + Intergenic
1007884460 6:45210515-45210537 AAGGCAGAACCTATTGAAGTGGG - Intronic
1008000790 6:46357708-46357730 CAGCTAGTACATGTTGAAGCTGG + Intronic
1008464253 6:51812998-51813020 AAGGTAGGACAACTTGAAGTGGG - Intronic
1008577450 6:52874491-52874513 AAGACAGAACATGTTGTAGCAGG - Intronic
1008977832 6:57448612-57448634 AAGGTGGGATATCTTGAAGCAGG + Intronic
1009165980 6:60341559-60341581 AAGGTGGGATATCTTGAAGCAGG + Intergenic
1009346462 6:62617667-62617689 AAGGTGAGACAACTTGAAGCAGG - Intergenic
1009590263 6:65660167-65660189 AATGTAAAAAATCATGAAGCTGG + Intronic
1009750812 6:67877358-67877380 AAGACAGAACAACTTGAAGGGGG + Intergenic
1010472527 6:76245744-76245766 AAAGCAGAACATCTTGAAGGAGG + Intergenic
1011392164 6:86866292-86866314 AACATAGAACATCTTATAGCAGG - Intergenic
1012648166 6:101716059-101716081 AAGGTAGAAAATGTAGAAACAGG - Intronic
1013475989 6:110507840-110507862 AAGGTAGGACAACTTGAAGCAGG - Intergenic
1014110174 6:117612080-117612102 AAGGTGGGACAACTTGAAGCAGG - Intergenic
1014315950 6:119864855-119864877 AAGGTGGGACATCTTTAAGCAGG - Intergenic
1015152766 6:130057096-130057118 AAGGGAGAGCTTCTAGAAGCAGG - Intronic
1015332935 6:132002755-132002777 AAGGTGGGGCAACTTGAAGCAGG + Intergenic
1015338762 6:132073404-132073426 AAGGTGAGACAACTTGAAGCAGG + Intergenic
1015824277 6:137295225-137295247 AAGGTGGAACAACTTGAAGCAGG - Intergenic
1015879837 6:137860684-137860706 AAGGTAGGACAACTTCAAGGAGG - Intergenic
1016028607 6:139314455-139314477 AAGGCAGGATAACTTGAAGCAGG - Intergenic
1016513347 6:144867715-144867737 AAGGTAGCACAACTGGAAGCAGG + Intergenic
1016968492 6:149741024-149741046 CAGATAAAACATCTGGAAGCAGG - Intronic
1017386060 6:153885142-153885164 AAGGCAGGACAACTTGAAGCGGG + Intergenic
1018155602 6:160982735-160982757 AATGTGGGACAACTTGAAGCAGG - Intergenic
1018367753 6:163138742-163138764 AAAGGAGAACATCTCCAAGCAGG - Intronic
1018759347 6:166877648-166877670 AAGCTGGGACAACTTGAAGCAGG + Intronic
1020024798 7:4891921-4891943 AAGGTGGGACAACTTGAAGCAGG - Intergenic
1020340566 7:7105128-7105150 AAGGTAGGAAGACTTGAAGCAGG - Intergenic
1020756941 7:12214485-12214507 AAAGCAGGACATTTTGAAGCAGG - Intronic
1020764899 7:12307219-12307241 AAAGTAGGATTTCTTGAAGCAGG - Intergenic
1020851249 7:13356104-13356126 AAGGAAGGACAGCTTGAAGCCGG - Intergenic
1021670929 7:23034047-23034069 AGGATAGAACATCTTGATGTGGG + Intergenic
1022124523 7:27342428-27342450 AATGAAGAACACCTTGAATCAGG - Intergenic
1022881787 7:34595351-34595373 AAGGTGGGACAACTTGAAGCCGG - Intergenic
1022981905 7:35612005-35612027 AAGGCAGGACATCCTGAAACGGG + Intergenic
1023216323 7:37866896-37866918 GAGGTGGGACAACTTGAAGCAGG + Intronic
1023391932 7:39719117-39719139 AAGGCAGGACAACTTGAAGCTGG + Intergenic
1023485465 7:40681708-40681730 AAGGCAGGACCTCTTGAAGTAGG + Intronic
1023667645 7:42541532-42541554 AAGATGGGCCATCTTGAAGCAGG + Intergenic
1023713520 7:43019928-43019950 AAGGTAGGACATCTCAAAGCAGG + Intergenic
1023736003 7:43236538-43236560 AAGGTGGGAAAACTTGAAGCAGG + Intronic
1023742089 7:43289849-43289871 AAGGCAGGACATCTTGAAGTGGG + Intronic
1024276462 7:47680997-47681019 AAGGTGGGACAACTTGAAGCAGG - Intergenic
1024328982 7:48137946-48137968 AAGGCAGGACAACTAGAAGCTGG + Intergenic
1024383711 7:48727054-48727076 AAGGTGGAATATCTTGAAGTGGG - Intergenic
1024898767 7:54293167-54293189 AAGGTGGGACATCTTGAAGTGGG + Intergenic
1024928753 7:54646947-54646969 AAGGTGGGACAACTTGAAACAGG + Intergenic
1025003138 7:55334857-55334879 AAGGTCGGACAACTTGAAGCTGG - Intergenic
1026119225 7:67522179-67522201 AAGGCAGGACAACTGGAAGCAGG - Intergenic
1026493893 7:70886527-70886549 AAAGCAGGACATCTTGAAGGTGG + Intergenic
1026520216 7:71110928-71110950 AAGGTAGGACAACTGGAAGTGGG + Intergenic
1026561854 7:71456927-71456949 AAGGTGGGACAACTCGAAGCGGG + Intronic
1026585610 7:71653709-71653731 AAAGTAGGACATCTTGAAGCAGG + Intronic
1026626816 7:72001005-72001027 TAGGTAGAAAAACCTGAAGCAGG + Intronic
1026735663 7:72946956-72946978 AAGGGAGAAGCTCTTGGAGCAGG + Intronic
1026786005 7:73301887-73301909 AAGGGAGAAGCTCTTGGAGCAGG + Intergenic
1027108058 7:75418055-75418077 AAGGGAGAAGCTCTTGGAGCAGG - Exonic
1027504842 7:79003264-79003286 AAGGAGGCACATCTTGGAGCTGG - Intronic
1027613849 7:80396490-80396512 ATGGTAGCACATCTTGAGGAGGG - Intronic
1027620738 7:80481941-80481963 AAGGCAGGACAATTTGAAGCGGG - Intronic
1029015807 7:97314495-97314517 AAGGTGGAATATCTTGAAATGGG + Intergenic
1030038244 7:105426474-105426496 AAGCTAGAAAAGTTTGAAGCTGG - Intergenic
1030118103 7:106079070-106079092 AAGGCAGGACAACTCGAAGCAGG - Intergenic
1030603358 7:111613391-111613413 AAGGCAGAATATCTGGAAGTGGG - Intergenic
1031038379 7:116813312-116813334 GAGGCAGAACAGCTTGAACCTGG - Intronic
1031353938 7:120767318-120767340 AAGGTGGGATATCTTGAAGCAGG - Intergenic
1031424537 7:121589179-121589201 AAGGTAGGACAACTCGAAGTGGG - Intergenic
1032420339 7:131774277-131774299 AAGGTGGGACAACTTAAAGCAGG - Intergenic
1033801239 7:144904981-144905003 ATGGTGGGACAACTTGAAGCAGG + Intergenic
1034237106 7:149580526-149580548 AAGGTGGGACAACTGGAAGCTGG + Intergenic
1035430587 7:158817465-158817487 AAGGTGGGACACCTGGAAGCAGG - Intronic
1035430592 7:158817502-158817524 AAGGTGGGACAGCTGGAAGCGGG - Intronic
1035430600 7:158817539-158817561 AAGGTGGGACACCTGGAAGCAGG - Intronic
1035476565 7:159148387-159148409 AAGGTGGGACATCTTGAAGCGGG - Intergenic
1035550239 8:517598-517620 AAGGCTGGACATCTTGAAGTGGG - Intronic
1035556454 8:570680-570702 GAGGTGGGACATCTTGAAGGGGG - Intergenic
1036008533 8:4694292-4694314 AAGGCAGGACAACTTCAAGCAGG - Intronic
1036486409 8:9183491-9183513 GAGGTGGGACAACTTGAAGCAGG + Intergenic
1036488612 8:9202633-9202655 AAGGTGGAATATCTTGAAGCAGG - Intergenic
1037138214 8:15489208-15489230 AAGGCAGGACAACTTGAAGTAGG + Intronic
1037736689 8:21572640-21572662 AAGGCAGGATATCTTGAAGCAGG + Intergenic
1037759916 8:21735002-21735024 AAGGCGGGACAACTTGAAGCGGG - Intronic
1038149707 8:24931380-24931402 AAGGCAGAACAACTCAAAGCAGG - Intergenic
1038279552 8:26151579-26151601 GAGTTAGAACACTTTGAAGCTGG + Intergenic
1038458372 8:27693882-27693904 AGGGTAGAACAACTTGAAGGAGG - Intergenic
1038857765 8:31351692-31351714 AGGGTGGAATATCTTGAAGTGGG + Intergenic
1039573451 8:38604920-38604942 AAGGTGGGACATCTTGAAGTGGG - Intergenic
1039690147 8:39854967-39854989 AAGGCAGGACAACTTGAGGCTGG + Intergenic
1039757407 8:40538343-40538365 AAGGTGGGACAACTAGAAGCGGG - Intronic
1039761703 8:40583765-40583787 AAGGTGGGACAACTTGAGGCGGG + Intronic
1039799354 8:40940871-40940893 AAGGTGGGACATCTTGAAGCAGG + Intergenic
1040010579 8:42657992-42658014 AAGGTAGGACATCTTGAAGCAGG + Intergenic
1040417313 8:47206770-47206792 AGGGTGGGATATCTTGAAGCAGG + Intergenic
1040717879 8:50280596-50280618 AAGGTGGGACAACTTGAAGAGGG + Intronic
1040851167 8:51901334-51901356 GAGGCAGAACTGCTTGAAGCCGG - Intergenic
1040944784 8:52873332-52873354 AAGGCAGGATACCTTGAAGCAGG + Intergenic
1041355209 8:56993226-56993248 CAGGTAGAACATCTTGCGGTTGG + Exonic
1041918364 8:63158258-63158280 AAGGTGGGACAACTTGAAGTGGG - Intergenic
1043222922 8:77689162-77689184 AAGGTAGGACATCTCAAAACCGG - Intergenic
1043483251 8:80673979-80674001 CAGGTAGAACATCATGGAGCTGG - Intronic
1043624074 8:82232866-82232888 AAGGTGAGACAACTTGAAGCAGG - Intergenic
1043732701 8:83704226-83704248 AGAATAGAACATCTTGGAGCAGG - Intergenic
1043765317 8:84123604-84123626 AAGGCAGGACAACTTGAAGCAGG - Intergenic
1044031449 8:87242581-87242603 AAGGTGGGACAACTTGAAGAGGG - Intronic
1044057370 8:87587811-87587833 AAGGTGGGACAACTCGAAGCAGG + Intronic
1044222425 8:89684972-89684994 AAGGCAGGACAACTTGAAGCAGG - Intergenic
1044309812 8:90680550-90680572 AAGGTGGGACAACTCGAAGCGGG - Intronic
1044648309 8:94468139-94468161 AAGGTGAGACATCTTGAAGTGGG - Intronic
1044720479 8:95140716-95140738 CAGGTAGAACATCTAGGAACAGG - Intronic
1045049514 8:98310056-98310078 AAGATAGGATATCTTGAAGCAGG + Intergenic
1045290774 8:100830761-100830783 AAGGCAGGACATCTGGAAGCAGG + Intergenic
1045526457 8:102944678-102944700 AATGGAGAACAGCTTGCAGCAGG + Intronic
1045666648 8:104494649-104494671 CAGGAAAAACATCTTCAAGCTGG - Intronic
1045791939 8:105994225-105994247 AAGGCAGGGCAACTTGAAGCAGG + Intergenic
1045877714 8:107001530-107001552 AAGGTGGGACAACTTGAAGCAGG + Intergenic
1046378748 8:113423843-113423865 AAATTAGTACATTTTGAAGCTGG - Intronic
1047188685 8:122658367-122658389 AAGGCAGAACATCTCAAAGACGG + Intergenic
1047522471 8:125605705-125605727 AAGGCAGGTCATCTTGAAGTGGG + Intergenic
1047558725 8:125963391-125963413 AAGGCAGGACAACTGGAAGCAGG - Intergenic
1048098098 8:131315974-131315996 AAGGAAGAACATCTAGCATCAGG - Intergenic
1048103566 8:131382038-131382060 AAGGCAGAATATCCTGAAGCAGG - Intergenic
1048370174 8:133770281-133770303 AAGGCAGGACAACTTGAAGAGGG - Intergenic
1048892676 8:138961852-138961874 AAGGTGGAACAACTCGAAGTGGG - Intergenic
1048960410 8:139572293-139572315 CCTGTAGAAAATCTTGAAGCTGG + Intergenic
1049250481 8:141586050-141586072 AAGGTGGAACAACTTGAAACAGG + Intergenic
1049523806 8:143110218-143110240 AAGGTGGGACAACTTGAAACAGG - Intergenic
1049539363 8:143200651-143200673 AAGGCAGGACATCTGGAAGCTGG - Intergenic
1050352741 9:4755794-4755816 AAGGTGAGATATCTTGAAGCAGG + Intergenic
1050636510 9:7618494-7618516 AGGGTGGAACAACTTGAAGCAGG - Intergenic
1050922880 9:11228467-11228489 AAGGCAGGAAAACTTGAAGCAGG + Intergenic
1051776203 9:20636919-20636941 TAAGTAGAGCATCTTGTAGCAGG - Intergenic
1051787885 9:20766072-20766094 TAGGCAGAACATCTTGAACTAGG + Intronic
1052171068 9:25397208-25397230 AAGGCAGGACAACTGGAAGCAGG - Intergenic
1052829080 9:33200203-33200225 AGGGTGGGACATCTTGAAGTGGG - Intergenic
1053032147 9:34789519-34789541 AAGGCAGAGAATCTTGAAGTTGG + Intergenic
1055314430 9:75019707-75019729 AAGGTAGGACATCTTAAAGAGGG - Intronic
1055776812 9:79775254-79775276 AAGGTGGGACATCTTGAAATGGG + Intergenic
1056391229 9:86143376-86143398 AATGCAGGATATCTTGAAGCAGG - Intergenic
1056661998 9:88550552-88550574 AAGGTGGGACATCTTGAAGCAGG + Intronic
1056891108 9:90493707-90493729 AAGGCAAGACAACTTGAAGCGGG - Intergenic
1057467871 9:95332098-95332120 AAGGTGGGACAACTCGAAGCAGG + Intergenic
1058131570 9:101259759-101259781 AAGGCGGGACAACTTGAAGCAGG + Intronic
1058667330 9:107332466-107332488 TCGGTAGAACATTTTGCAGCAGG - Intergenic
1058787692 9:108406377-108406399 AAGGTGGGATATCTTGAAGCAGG - Intergenic
1058996878 9:110307784-110307806 AAGGCAGGACAACTTGAAGCGGG - Intronic
1059214528 9:112548328-112548350 AAGGCAGAACACCTCGAAGAGGG - Intronic
1059529823 9:115025618-115025640 AAGGTAAAACAGCTTGTAGAAGG - Intronic
1059872057 9:118588360-118588382 AAGGCAGGACAACTTGAAGCAGG + Intergenic
1060491273 9:124086511-124086533 AAGGCAGAACTGCTTGAACCTGG + Intergenic
1061031227 9:128084563-128084585 AAGGTGGGACAACTTGAAGGCGG - Intronic
1061091225 9:128427777-128427799 AAGGTAACAAATATTGAAGCCGG + Intronic
1061321472 9:129833333-129833355 TTAGTAGGACATCTTGAAGCAGG - Intronic
1061824658 9:133250581-133250603 AAGGTAGGACAACTCGAAGGTGG + Intronic
1062272183 9:135714615-135714637 CAGGTCGCTCATCTTGAAGCCGG - Exonic
1203583763 Un_KI270746v1:43429-43451 CAGGGAGAACAGCTTGAACCAGG - Intergenic
1185788838 X:2913145-2913167 AAGGTGGAACAACTGGAAGTGGG + Intronic
1186034085 X:5402323-5402345 AAGTTGGAATATCTTGAAGTAGG + Intergenic
1186148024 X:6645240-6645262 AAGGTGGAATAACTTGAAGCAGG + Intergenic
1186691182 X:11977690-11977712 AAGGCAGGACAACTGGAAGCTGG + Intergenic
1186878351 X:13839284-13839306 AAGGTGGGACATCTTGAAGTTGG - Intronic
1187057319 X:15753251-15753273 AAGGTAGGACATCTCTAAGCAGG + Intronic
1187854543 X:23624183-23624205 AGGGTAGGATATGTTGAAGCGGG - Intergenic
1188074145 X:25754745-25754767 AAGGAGGGACATCTTGAAGGTGG - Intergenic
1188751278 X:33908422-33908444 AAGGCAGAACAACTAGAAACAGG - Intergenic
1188876765 X:35440323-35440345 AAGGCAGGACAACTCGAAGCAGG - Intergenic
1188911445 X:35852846-35852868 AAGGTGGGACAACTGGAAGCAGG - Intergenic
1189188000 X:39070500-39070522 AAGGCAGGACAACTCGAAGCAGG + Intergenic
1189634584 X:42992534-42992556 AAGGTGGGATAACTTGAAGCAGG - Intergenic
1189957078 X:46286946-46286968 AAGGTGGGACATCTCAAAGCAGG + Intergenic
1190185144 X:48227114-48227136 AAGGCAGGACAACTCGAAGCAGG - Intronic
1190197873 X:48335151-48335173 AAGGCAGGACAACTTGAAGCAGG - Intergenic
1190408267 X:50109467-50109489 AAGGTAGGACAACTGGAAGCAGG - Intergenic
1190664618 X:52685585-52685607 AAGGCAGGACAACTCGAAGCAGG - Intronic
1190674804 X:52772833-52772855 AAGGCAGGACAACTCGAAGCAGG + Intronic
1191733092 X:64358582-64358604 AAAGTAGTAAATGTTGAAGCTGG + Intronic
1191845268 X:65542550-65542572 AAGGTGGGACAACTCGAAGCAGG - Intergenic
1192549423 X:72042166-72042188 AAAGTAGAACATCTGGGGGCAGG - Intergenic
1192792303 X:74394650-74394672 AAGGGAGAATCTCTTGAACCTGG - Intergenic
1192802893 X:74484307-74484329 AAGGCAAAACAACTTGAAGTTGG + Intronic
1192803596 X:74491304-74491326 AAGGTGAAACAACTTGAAGCTGG + Intronic
1193213819 X:78839431-78839453 AAAGTGGAACAACTTGAGGCAGG - Intergenic
1193283889 X:79688973-79688995 AAGGCAGAACACCTCAAAGCAGG + Intergenic
1193302644 X:79908849-79908871 AAGGTGGGACAACTTGAAGCAGG - Intergenic
1193416239 X:81228301-81228323 AAGGCAGAACAACTGGAAGCAGG + Intronic
1193821486 X:86170909-86170931 AAGGCAGGACAACTTGAAGTAGG + Intronic
1193850934 X:86536672-86536694 AAGGTGGGACATCTTGAAGTGGG - Intronic
1194014879 X:88606624-88606646 AAGGCAGGACAACTTGAAGTGGG - Intergenic
1194092301 X:89592882-89592904 AAGGTGGGACAACTGGAAGCAGG - Intergenic
1194130777 X:90079314-90079336 AAGGCGGGACAACTTGAAGCAGG - Intergenic
1194200422 X:90948121-90948143 AAGGTGGAACAACTCAAAGCAGG - Intergenic
1194266867 X:91764861-91764883 AAGGTGGGACAACTTGAAGCAGG - Intergenic
1194296636 X:92133994-92134016 AAGGTGGGACAACTTGAAGTGGG + Intronic
1194456906 X:94116031-94116053 AAGGCACAACAACTTGAAGTAGG + Intergenic
1194483352 X:94454944-94454966 AAGGCAGGACAACTTGAAGTGGG - Intergenic
1194502354 X:94697400-94697422 AAGGTGGGACAACTTGAAGTAGG + Intergenic
1194507467 X:94750475-94750497 AAGGTGGGACATCTTGAAGGGGG + Intergenic
1194822239 X:98523908-98523930 AAGGTAGGATATCTTGAAGACGG - Intergenic
1194843929 X:98779959-98779981 AAGGTGGGATATCTTGAAGTGGG + Intergenic
1194886494 X:99321911-99321933 AAAGTGGGACAACTTGAAGCGGG - Intergenic
1195401217 X:104463522-104463544 AAGGCAGGACAACTTGAAGCAGG - Intergenic
1195462855 X:105146881-105146903 AAGGCAGGACATCTTGAAGAAGG + Intronic
1195657249 X:107343862-107343884 AAGGTAGGATATCTTGAAGCAGG - Intergenic
1196223029 X:113134566-113134588 AAGGCAGGGCATCTTGAAGTGGG + Intergenic
1196884279 X:120228153-120228175 AAGGTGGGACAACTCGAAGCAGG - Intergenic
1196974178 X:121140653-121140675 AAGGCAGGACAACTTGAAGCAGG + Intergenic
1197025990 X:121750100-121750122 AAGGCAGGACATCATGAAGTGGG - Intergenic
1197213817 X:123849674-123849696 AAGGCAGGACAACTTGAAGTGGG - Intergenic
1197568728 X:128121512-128121534 AAGGTGGGACAGCTTGAAGTGGG + Intergenic
1197930475 X:131689906-131689928 AGGGTAGGACAACTTAAAGCAGG + Intergenic
1198276844 X:135102793-135102815 AAGGCAGGACAACTAGAAGCAGG + Intergenic
1198692166 X:139296181-139296203 AAAGTAGAACATATTGAGGGTGG + Intergenic
1198747140 X:139902192-139902214 AAGGCGGGACAACTTGAAGCTGG - Intronic
1198825135 X:140691340-140691362 AAGGTGGGACACCTTAAAGCAGG + Intergenic
1199150892 X:144485623-144485645 AAGGCAGAACAACTCAAAGCAGG - Intergenic
1199160749 X:144608107-144608129 AAGATAGAACAACTTGAAGTGGG + Intergenic
1199253779 X:145695340-145695362 CAGGGAGAACATCCTGAAGGAGG - Intergenic
1200285853 X:154821547-154821569 AAGGTGGGACAACTTGAAGTGGG + Intergenic
1200444931 Y:3248919-3248941 AAGGTGGGACAACTGGAAGCAGG - Intergenic
1200546416 Y:4524542-4524564 AAGGTGGAACAACTCAAAGCAGG - Intergenic
1200584067 Y:4985773-4985795 AAGGTGGGACAACTTGAAGCAGG - Intergenic
1200614150 Y:5358564-5358586 AAGGTGGGACAACTTGAAGTGGG + Intronic
1201261048 Y:12159200-12159222 AAGGTGGGACAACTTGGAGCAGG - Intergenic
1201348664 Y:13014369-13014391 AAGGTAAGACAACTTGAAGTGGG - Intergenic
1201613107 Y:15865168-15865190 AAGGCAGGATATCCTGAAGCAGG - Intergenic
1201667125 Y:16470849-16470871 AAGGTGGGACAACTTGAAGCAGG + Intergenic
1201672782 Y:16542863-16542885 ATGGTAGGACAACTTGAAGTGGG - Intergenic
1201897436 Y:19007138-19007160 AAGGCTGAAAATCTTGAAACTGG + Intergenic
1201914569 Y:19168422-19168444 AAGGCGGGACAACTTGAAGCCGG - Intergenic
1202167303 Y:22003446-22003468 AGGGAAGAGCAACTTGAAGCAGG + Intergenic
1202224057 Y:22582923-22582945 AGGGAAGAGCAACTTGAAGCAGG - Intergenic
1202242745 Y:22787898-22787920 AAGGGTGAACCTCTTGATGCCGG - Intergenic
1202319058 Y:23612738-23612760 AGGGAAGAGCAACTTGAAGCAGG + Intergenic
1202395732 Y:24421648-24421670 AAGGGTGAACCTCTTGATGCCGG - Intergenic
1202475053 Y:25248444-25248466 AAGGGTGAACCTCTTGATGCCGG + Intergenic
1202551711 Y:26057319-26057341 AGGGAAGAGCAACTTGAAGCAGG - Intergenic