ID: 1086606785

View in Genome Browser
Species Human (GRCh38)
Location 11:88705158-88705180
Sequence TACTCTGTCCAGTGTGGGGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 184
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 168}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1086606780_1086606785 18 Left 1086606780 11:88705117-88705139 CCCATATCATAAAAGAAGCAGAA 0: 1
1: 0
2: 10
3: 60
4: 777
Right 1086606785 11:88705158-88705180 TACTCTGTCCAGTGTGGGGTTGG 0: 1
1: 0
2: 0
3: 15
4: 168
1086606781_1086606785 17 Left 1086606781 11:88705118-88705140 CCATATCATAAAAGAAGCAGAAT 0: 1
1: 0
2: 6
3: 25
4: 423
Right 1086606785 11:88705158-88705180 TACTCTGTCCAGTGTGGGGTTGG 0: 1
1: 0
2: 0
3: 15
4: 168

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086606785 Original CRISPR TACTCTGTCCAGTGTGGGGT TGG Intronic
900790649 1:4677833-4677855 TTCTCTGTCCATTGTGGTGCTGG + Intronic
904823495 1:33259649-33259671 ATGTCTGTCCAGTGTGGGCTGGG - Intronic
905009382 1:34736908-34736930 CACTCTGTGCAGTGTGGAGGCGG - Intronic
905477671 1:38240320-38240342 TACTTTGTGCAGTGCTGGGTAGG + Intergenic
907711076 1:56881993-56882015 TAATCTGTAGAGTGTGGGGGAGG + Intronic
909512351 1:76468726-76468748 TTCCCTGTCCAGTGTGTGATGGG + Intronic
911301063 1:96174577-96174599 TACTATGTCCAGTGTTGGACAGG + Intergenic
912449945 1:109762467-109762489 TACCCTGGGCAGGGTGGGGTTGG - Intronic
912463090 1:109850353-109850375 TTCTCTGTATAGTGTGGAGTTGG + Intergenic
912546851 1:110457227-110457249 TCCTCTGTCCAGATTGGGGTGGG + Exonic
913066970 1:115264922-115264944 TACTGTGGCCAGTGTGGCTTGGG + Intergenic
915343250 1:155187534-155187556 TTCTCTGCCCAGTCTGGGGCTGG - Exonic
915473120 1:156137512-156137534 TACTCTGTCCTCTGTGGTGATGG - Intronic
916211127 1:162360800-162360822 TTCTGTGTCCAGTGTGTGGTGGG + Intronic
919110763 1:193216472-193216494 TAATCTGTCTGGTTTGGGGTTGG - Intronic
919563059 1:199147429-199147451 TACTCAGTCCAGATTGGAGTAGG + Intergenic
920048709 1:203150428-203150450 GACTCTGTACACTGTGGGCTTGG + Intronic
922184116 1:223258870-223258892 CACTCTTTGCTGTGTGGGGTTGG - Intronic
1062942889 10:1438127-1438149 TGCTCTGTCCACTGAGGGGAAGG - Intronic
1063128687 10:3158814-3158836 GACACTGTCAAGTGTGGGGCCGG + Intronic
1066408637 10:35144140-35144162 TGCTTTGTCCAGTGTGGTGATGG + Intronic
1067204365 10:44200529-44200551 TAGTGGGGCCAGTGTGGGGTGGG + Intergenic
1067746252 10:48938642-48938664 GATGCTGTGCAGTGTGGGGTAGG + Intronic
1072816755 10:98517180-98517202 TTCTCTGTTGGGTGTGGGGTGGG + Intronic
1073208795 10:101782392-101782414 CACTCATTACAGTGTGGGGTGGG - Intronic
1073708251 10:106011137-106011159 TAAGCTGTGCAGTCTGGGGTTGG + Intergenic
1074550021 10:114434039-114434061 TACTCTGGAAAGTGTGGGGATGG - Intronic
1076102653 10:127795295-127795317 TACTCTGTAAAGTGGGGGGTAGG + Intergenic
1077910877 11:6570553-6570575 TACTCTCTCGAGTCTAGGGTGGG + Intronic
1085245483 11:75097626-75097648 GACTTTGTCCTGTATGGGGTTGG - Intergenic
1086205620 11:84255065-84255087 TGCTCTGTGTAGTCTGGGGTGGG - Intronic
1086606785 11:88705158-88705180 TACTCTGTCCAGTGTGGGGTTGG + Intronic
1089613552 11:119682833-119682855 TACAGTGTCCAGTATGGAGTAGG - Intronic
1094795097 12:33962611-33962633 TTGTCTGTCCAGTGTGATGTTGG + Intergenic
1095381105 12:41593555-41593577 TGCTCTGTACAGTGTGAGCTAGG + Intergenic
1096087732 12:48877381-48877403 TCCTCTATACAGTGTGAGGTCGG + Intergenic
1097193609 12:57232071-57232093 TGCTCTGTCCACTCTGTGGTAGG - Intronic
1097461665 12:59871142-59871164 CACACTGTGCTGTGTGGGGTTGG - Intergenic
1099812867 12:87607005-87607027 TCCTCTTTCCTGTGTGGTGTAGG - Intergenic
1102385098 12:112502237-112502259 TACTCTGCACAGGGTGGCGTTGG - Exonic
1104484129 12:129134944-129134966 TAATTGGTCCAGTGTGGGTTTGG - Intronic
1109661165 13:65462465-65462487 CACTGTGTCCTGTCTGGGGTTGG - Intergenic
1112231532 13:97593081-97593103 TACCCTGTCCATTGCAGGGTAGG + Intergenic
1112805199 13:103157125-103157147 TACGCTGTCCAGTATGGTGAAGG + Intergenic
1116120915 14:40721435-40721457 TACTCTGCCCCATGTGGGATAGG - Intergenic
1118711552 14:68523557-68523579 TCCTCTATCCAGTTTGGGTTAGG - Intronic
1120125756 14:80740961-80740983 TAGTATTTCCAGTTTGGGGTAGG - Intronic
1121493370 14:94375801-94375823 TGCTCTGTCCAGTGTGGGCCTGG - Intergenic
1123115772 14:105893405-105893427 TACTCTGCCCTCTGTGGGGAGGG - Intergenic
1129909811 15:79217429-79217451 TACTCTGTGCAGTGTCAGCTGGG + Intergenic
1129934558 15:79438145-79438167 TAGTGTGTGGAGTGTGGGGTGGG + Intronic
1129934603 15:79438308-79438330 TAGTGTGTGGAGTGTGGGGTGGG + Intronic
1131138006 15:89953172-89953194 TACAGTGTACATTGTGGGGTTGG + Intergenic
1132605022 16:790054-790076 TAAGCTGGCCAGTGAGGGGTGGG - Intronic
1133444856 16:5851289-5851311 TGCTCTGCCCAGTGTGCAGTGGG + Intergenic
1134358621 16:13508519-13508541 TTATCTTTCCAGGGTGGGGTGGG + Intergenic
1136362909 16:29792706-29792728 TAGTCACTCCAGGGTGGGGTGGG + Intronic
1139494046 16:67303118-67303140 TGCTCTGTCCGGGGTGGGGTGGG - Intronic
1140591187 16:76354694-76354716 AACTCTATCCAGTGGTGGGTTGG - Intronic
1141157090 16:81604833-81604855 GCCTCTGTCCAGTGTGTTGTGGG + Intronic
1143046727 17:4086850-4086872 GACTCTGCCCACTGTGGGGAAGG + Intronic
1143959410 17:10702676-10702698 TCCTCTGGCCAGTTAGGGGTAGG - Intronic
1144780385 17:17805456-17805478 GACTCTGTCCACTGGGAGGTGGG - Intronic
1146741604 17:35288891-35288913 TTCTCTGTGCACTTTGGGGTTGG - Intergenic
1149631213 17:58125789-58125811 TAACCTGTCCAGTTTGTGGTAGG - Intergenic
1149654117 17:58301425-58301447 TTCCCTGTTCAGAGTGGGGTAGG - Intronic
1149952436 17:61003985-61004007 TCCTCTGTTCAGGGTGGGGTTGG + Intronic
1150814084 17:68378910-68378932 CCTTCTGTCCAGTTTGGGGTCGG + Intronic
1152706124 17:81844557-81844579 TACTCTGCCCAGGCTGGGGATGG - Intronic
1152771427 17:82172039-82172061 CACTCTGGCCAGTGAGGGGAGGG - Intronic
1153635099 18:7106692-7106714 TAGTGTGTCCGGTCTGGGGTGGG - Intronic
1153704949 18:7735955-7735977 TATTTTGGCCAGGGTGGGGTGGG - Intronic
1155168102 18:23247381-23247403 TACTCTGAACAGTGTGGGGCTGG + Intronic
1161841823 19:6686321-6686343 TGCTCTGTCCAGCCTGGGGATGG + Intronic
1162805910 19:13137978-13138000 AACTCAGTCCGGTGTAGGGTTGG + Intronic
1164521569 19:28983838-28983860 TGCTCTGACCAATGTGTGGTGGG - Intergenic
1167851116 19:52203157-52203179 CCATCTGTCCAGTGTGGGGAGGG - Intronic
1168438282 19:56340038-56340060 TTCTCTGTCCATTTTGGGTTTGG - Intronic
925858155 2:8150338-8150360 TGCTCTGCACAGTGTGGGGCAGG - Intergenic
927475635 2:23412380-23412402 TACTCAGTCCAGTGAGAAGTGGG + Intronic
929773720 2:44914615-44914637 TACTCAGTCTAGTGTGGGCTAGG + Intergenic
930220113 2:48737860-48737882 TTCTCTGTAAAGTGAGGGGTTGG - Intronic
930422954 2:51176894-51176916 TGCTGTGGCCAATGTGGGGTTGG - Intergenic
932358163 2:71083662-71083684 TTCCCTGTCCAGTCTGGGGGAGG + Intergenic
932370357 2:71182143-71182165 TTCCCTGTCCAGTCTGGGGGAGG + Intergenic
932370502 2:71183229-71183251 TTCCCTGTCCAGTCTGGGGGAGG + Exonic
939352749 2:141061185-141061207 TAATCTGTCTGGGGTGGGGTTGG - Intronic
939568039 2:143807942-143807964 TACTCTGTTCAGTGTTGCTTTGG - Intergenic
942332083 2:174837056-174837078 TTCTTAGTCCAGTGTGGGCTGGG + Intronic
943075171 2:183185796-183185818 TATGCAGTCCAGTGTGGAGTAGG + Intergenic
943674909 2:190707153-190707175 TCCTCTGTGCAGTGGGGGTTTGG + Intergenic
944582751 2:201146734-201146756 GAATCTGTCCTGTGTGTGGTGGG + Intronic
946832056 2:223737098-223737120 TACTCTGACCTGTGGGGTGTGGG + Intergenic
947116269 2:226774447-226774469 AACTATGTCCAGTGTGGAGTTGG + Intronic
947807414 2:232978067-232978089 AACTCAGTCCAGTGTCGGTTAGG - Intronic
948391756 2:237616505-237616527 TACTGTGTGCAGTGTGTGGAAGG - Intergenic
1168836604 20:881804-881826 CACTCTGTCCAGAGTGTGGAGGG + Intronic
1170363748 20:15577323-15577345 TACTCAGCGCAGGGTGGGGTTGG - Intronic
1172596692 20:36155016-36155038 TCCCCTGGCCAGTGTGGGGGAGG + Intronic
1172848452 20:37944278-37944300 CACTCTGTACAGCGTGGGGGCGG - Exonic
1172900546 20:38331461-38331483 TACTCTTCCAAGTATGGGGTAGG + Intronic
1176021806 20:62966049-62966071 TGCTCTGGCCAGTGGGTGGTTGG + Intronic
1176021820 20:62966104-62966126 TGCTCTGGCCAGTGGGTGGTTGG + Intronic
1176021834 20:62966159-62966181 TGCTCTGGCCAGTGGGTGGTTGG + Intronic
1176021848 20:62966214-62966236 TGCTCTGGCCAGTGGGTGGTTGG + Intronic
1176021862 20:62966269-62966291 TGCTCTGGCCAGTGGGTGGTTGG + Intronic
1176021876 20:62966324-62966346 TGCTCTGGCCAGTGGGTGGTTGG + Intronic
1176277304 20:64279681-64279703 TCCTCTGCCCAGTGAGGGCTGGG + Intronic
1179412723 21:41174669-41174691 TGCTGTACCCAGTGTGGGGTTGG - Intronic
1181167266 22:20990531-20990553 TACTCTGGCCAGTGGGGTGGAGG + Intronic
1181886187 22:26024127-26024149 TATTGAGTCCAGTGTGGGGTTGG + Intronic
1182365912 22:29779215-29779237 CACTCTGTACTGTGTGGGGCAGG + Intergenic
1182737488 22:32541422-32541444 TTCTCTGTCCAGTGTGGCTGAGG - Intronic
1183403018 22:37615807-37615829 TCGACTGTCCAGTGGGGGGTTGG + Intronic
1184123839 22:42472753-42472775 TACACTCTCTAGTGTGGAGTGGG + Intergenic
1184387209 22:44182959-44182981 TACTTTGTCCTGTCTGGGATAGG + Intronic
1184804970 22:46788890-46788912 TCCTCTGTGGAGTGAGGGGTGGG + Intronic
950437336 3:12987923-12987945 GACAATGCCCAGTGTGGGGTTGG + Intronic
950601736 3:14041145-14041167 TACTGTGTCTTGTGTGTGGTGGG - Intronic
956166058 3:66399154-66399176 AAGTCTGTCCAGTGAGGGGCAGG + Intronic
961672338 3:128542374-128542396 TGCTGTGGCCATTGTGGGGTGGG - Intergenic
965688320 3:171328755-171328777 CACCCTCTCCAGTGTGGGGGTGG + Intronic
967331953 3:188298834-188298856 TATTCTGCCCAGTGTGGGATGGG + Intronic
967875687 3:194267101-194267123 TTCTCTGTCCAGAGTGAGGCAGG - Intergenic
969355233 4:6621150-6621172 TGATCTGTCCAGTGTGGCCTGGG - Intronic
971073810 4:23125530-23125552 AACTCTGGCAAGGGTGGGGTGGG - Intergenic
974050221 4:56934712-56934734 AATTCTATCCAGTGTGGGGGAGG - Exonic
976459056 4:85286460-85286482 TCCTCAGTCCAGTGTGGTCTTGG + Intergenic
979542506 4:121901455-121901477 TTAACTGACCAGTGTGGGGTAGG - Intronic
981624056 4:146736523-146736545 TACTCTGTACTGTGTGGGCTTGG - Intronic
984588089 4:181586131-181586153 AACTTTGGCCAGAGTGGGGTAGG - Intergenic
987137650 5:14914647-14914669 TACACTCTTCAGTGTGGGGGCGG - Intergenic
993843915 5:92915684-92915706 TACTTTGTCCAGTGTTTTGTAGG - Intergenic
995712917 5:115052925-115052947 AACCCTGGCCAGTGTGCGGTTGG + Intergenic
998417524 5:141956589-141956611 CTCTCTGTCCAGTGTGGCATTGG + Exonic
1000782097 5:165494974-165494996 TACTCTGTTCTGTGTGGGGCTGG + Intergenic
1000945967 5:167423421-167423443 TATTCTGTCCACTGTGCTGTTGG + Intronic
1001189847 5:169619582-169619604 TAATCAGTACAGTGTGGTGTTGG + Intergenic
1006614625 6:35318070-35318092 TACTTTGTCCAGCGGGAGGTTGG + Intronic
1007055249 6:38876750-38876772 TAGTCTTGCCAGTGTGGGGAAGG - Intronic
1007150510 6:39685760-39685782 TACTGTGCCCCATGTGGGGTTGG - Intronic
1009729735 6:67585059-67585081 TTCTCTGTTCAGTCTGAGGTTGG + Intergenic
1011228876 6:85137598-85137620 TTCTTTGTCCCGTTTGGGGTTGG + Intergenic
1011785025 6:90833973-90833995 CACTGTCTTCAGTGTGGGGTGGG + Intergenic
1012327298 6:97937544-97937566 GACTTTGGCCAGTCTGGGGTTGG + Intergenic
1018093326 6:160363609-160363631 TGCTCTGTCCTGTGGGGAGTGGG - Intronic
1024993167 7:55252150-55252172 TACTCTTTCCAATGTGCGGGAGG - Intronic
1028255636 7:88593506-88593528 TACTGTAGGCAGTGTGGGGTTGG - Intergenic
1030323203 7:108191757-108191779 GACGCTGTCCAGAGTGGTGTTGG + Exonic
1031341690 7:120610529-120610551 TTCTGATTCCAGTGTGGGGTAGG + Intronic
1032279335 7:130488225-130488247 TTCTCTGTCCACTGGGGGCTGGG - Intronic
1032630121 7:133641647-133641669 TACTCTGTCCAGTGTGCTGAAGG + Intronic
1034954886 7:155328003-155328025 TCCTCTGTCCTGGGTGGGATGGG + Intergenic
1035461374 7:159041202-159041224 TGCTCTGTGCAGTGTGTGGGAGG + Intronic
1035735417 8:1883803-1883825 AGCTCTGTCCAGTGAGGAGTTGG + Intronic
1035767675 8:2119948-2119970 CACTCTTTCCAGTGAAGGGTTGG + Intronic
1044475688 8:92623170-92623192 TTTTCTGTACAGTGTGAGGTAGG + Intergenic
1045841443 8:106586669-106586691 TAGTATTTCCAGTGTTGGGTAGG + Intronic
1048449779 8:134523248-134523270 TACTCTGTCCCGTGTCGCCTAGG + Intronic
1051692147 9:19726563-19726585 TACTCTGTTCAGTTTGGAGAAGG - Intronic
1052284324 9:26767858-26767880 TCCTGTTTCAAGTGTGGGGTTGG + Intergenic
1053513315 9:38708090-38708112 TTCTTTGGCCAGTGTGGTGTTGG - Intergenic
1055040439 9:71865099-71865121 CACTCTTTCTAGTGTGGGGGTGG + Intronic
1056056282 9:82827102-82827124 TGCTGAGTCAAGTGTGGGGTGGG + Intergenic
1058878012 9:109260845-109260867 TACTCTGTTAAGTGTGGTGAGGG + Intronic
1059693820 9:116711939-116711961 GACTCTGGCTAGTGTGGGATAGG - Intronic
1059775492 9:117470589-117470611 TACTCTGACCAGTGTGAGCAAGG - Intergenic
1061961126 9:133989892-133989914 TCCTCTGTCCCGTGGAGGGTGGG - Intronic
1062030572 9:134360141-134360163 TGCTCTGTCCTGCCTGGGGTGGG + Intronic
1188261271 X:28027099-28027121 TCCTCTGTCCAGTTTGGGGGAGG + Intergenic
1189695392 X:43656445-43656467 GACCCTGGCCAGTGAGGGGTAGG + Intronic
1190279794 X:48922181-48922203 GACTCTGTTCTGTGTGGGGCAGG - Intronic
1190810488 X:53878743-53878765 TAATCAGTCCAGGATGGGGTTGG - Intergenic
1191197633 X:57741496-57741518 TCCTGTGGCCAGTGTGGGCTTGG + Intergenic
1193676365 X:84457904-84457926 AATTCTATCCAGTGTGGGGGAGG + Intronic
1198341066 X:135713792-135713814 TTCTCTGTCTGGTGTGTGGTAGG + Intronic
1198346863 X:135767830-135767852 TTCTCTGTCCGGTGTGTGGGAGG - Intronic
1198348770 X:135785114-135785136 TTCTCTGTCCGGTGTGTGGGAGG - Intergenic
1198350675 X:135802388-135802410 TTCTCTGTCCGGTGTGTGGGAGG - Intronic
1198352582 X:135819651-135819673 TTCTCTGTCCGGTGTGTGGGAGG - Intronic
1198354491 X:135836919-135836941 TTCTCTGTCCGGTGTGTGGGAGG - Intronic
1198356401 X:135854177-135854199 TTCTCTGTCCGGTGTGTGGGAGG - Intronic
1198358314 X:135871451-135871473 TTCTCTGTCCGGTGTGTGGGAGG - Intergenic
1198360813 X:135893221-135893243 TTCTCTGTCGGGTGTGTGGTAGG - Intronic