ID: 1086607158

View in Genome Browser
Species Human (GRCh38)
Location 11:88709585-88709607
Sequence TCACCTCAGTGTCATCCTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 190
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 174}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1086607152_1086607158 21 Left 1086607152 11:88709541-88709563 CCTCTCTGAAGTGAACTAATCAA 0: 1
1: 0
2: 0
3: 16
4: 170
Right 1086607158 11:88709585-88709607 TCACCTCAGTGTCATCCTGAGGG 0: 1
1: 0
2: 0
3: 15
4: 174
1086607150_1086607158 25 Left 1086607150 11:88709537-88709559 CCCACCTCTCTGAAGTGAACTAA 0: 1
1: 0
2: 0
3: 19
4: 202
Right 1086607158 11:88709585-88709607 TCACCTCAGTGTCATCCTGAGGG 0: 1
1: 0
2: 0
3: 15
4: 174
1086607151_1086607158 24 Left 1086607151 11:88709538-88709560 CCACCTCTCTGAAGTGAACTAAT 0: 1
1: 0
2: 0
3: 26
4: 304
Right 1086607158 11:88709585-88709607 TCACCTCAGTGTCATCCTGAGGG 0: 1
1: 0
2: 0
3: 15
4: 174
1086607149_1086607158 29 Left 1086607149 11:88709533-88709555 CCAACCCACCTCTCTGAAGTGAA 0: 1
1: 0
2: 0
3: 16
4: 208
Right 1086607158 11:88709585-88709607 TCACCTCAGTGTCATCCTGAGGG 0: 1
1: 0
2: 0
3: 15
4: 174

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086607158 Original CRISPR TCACCTCAGTGTCATCCTGA GGG Intronic
902369894 1:15999412-15999434 TCACCTCAGGATCATTGTGAAGG + Intergenic
902552653 1:17228767-17228789 TTCCCTCAGTGTCAGCCTGGTGG + Exonic
905446337 1:38030525-38030547 TCATCTCTCTGTCATCCTGCTGG + Intergenic
905645576 1:39623035-39623057 TCACCAAACTATCATCCTGATGG + Intergenic
907556432 1:55348519-55348541 TGGCCTCAGCATCATCCTGAGGG + Intergenic
907770043 1:57452562-57452584 CCACTTCAGTTTCATCCTGGTGG - Intronic
908770684 1:67592895-67592917 TCACCTCAGTCACCTCCAGAAGG - Intergenic
912530534 1:110317821-110317843 TCACCTCATTGTCTTTCTGAGGG - Intergenic
912984090 1:114408933-114408955 TCACCTCAGAATCCTCCTCAGGG + Intronic
913693918 1:121305959-121305981 TCAACACAGTCCCATCCTGATGG - Intronic
914143646 1:144974107-144974129 TCAACACAGTCCCATCCTGATGG + Intronic
915120342 1:153626619-153626641 TCACATCAGTCTCAGCCTGGAGG + Intronic
915778557 1:158519203-158519225 TCACCTGAGAAGCATCCTGAAGG + Intergenic
917035904 1:170746579-170746601 ACTCCTGAGTGTCATACTGAGGG - Intergenic
917471825 1:175332303-175332325 TCACTTCAGTGTGATCCCTAAGG - Intronic
918136597 1:181679645-181679667 TCACTGCAGTGCCATCCTGATGG - Intronic
918375003 1:183900218-183900240 TCACCTCGATGTAGTCCTGAAGG - Exonic
918380705 1:183952332-183952354 TCTCCTCAAAGTCATCCAGATGG - Intronic
918848338 1:189648275-189648297 TCACGTCAGTGACATCATGTTGG + Intergenic
920481242 1:206324338-206324360 TCAACACAGTCCCATCCTGATGG - Intronic
1062870092 10:893740-893762 TGGCCTCTGTGTCTTCCTGATGG - Intronic
1064846000 10:19653917-19653939 TCAACCCAGAGTCATCCAGATGG + Intronic
1065816886 10:29490895-29490917 TCTGCTCAGTGTATTCCTGAAGG + Exonic
1065955961 10:30693598-30693620 TCTGCTCAGTGTATTCCTGAAGG - Intergenic
1066225875 10:33382792-33382814 TGACATCACTGTCATTCTGAGGG - Intergenic
1067837694 10:49651734-49651756 ACACCTCAGTGCACTCCTGAAGG + Intronic
1069559780 10:69421202-69421224 TCACCTCCTTGTCACACTGATGG + Intergenic
1071100169 10:82027682-82027704 TCAGCTCAGGTTCAACCTGATGG - Intronic
1073517609 10:104091292-104091314 GCATGTCAGTGTCATTCTGAGGG + Intergenic
1076180634 10:128404693-128404715 TCTCCTCTGTGTGCTCCTGATGG - Intergenic
1079526325 11:21393164-21393186 TCATCTCTGTGGCATCTTGATGG - Intronic
1079562745 11:21843248-21843270 TCAGTTCAGTGTCATCCCAAAGG + Intergenic
1081158445 11:39723965-39723987 TCACCTCATTGTCATATTGATGG - Intergenic
1083110453 11:60401087-60401109 TCACTTCTGTGTTAACCTGAAGG + Intronic
1083474636 11:62908183-62908205 TGACCTGAGGGTCATCCTGATGG + Intergenic
1086235955 11:84630723-84630745 TCACCTCAATATTATTCTGATGG + Intronic
1086607158 11:88709585-88709607 TCACCTCAGTGTCATCCTGAGGG + Intronic
1089252091 11:117171825-117171847 TCACCTCAGTGGTATACTGTTGG + Intronic
1089685996 11:120147201-120147223 CCATCTCAGTGCCATCCTGCTGG + Intronic
1091913955 12:4254161-4254183 TCACATCAGAGAGATCCTGATGG - Intergenic
1095267114 12:40173549-40173571 TCACCTCAGTCTCAGCATCAGGG - Intergenic
1097703739 12:62846541-62846563 CCATATCAGTGTCTTCCTGACGG + Intronic
1100799762 12:98218886-98218908 GCACCTCAGAGTCATCCTGTGGG - Intergenic
1104306600 12:127615643-127615665 TGGCCTCAGTGTCTGCCTGACGG - Intergenic
1106412952 13:29523805-29523827 TCACAACATTGTCATCCTGGCGG - Intronic
1106641766 13:31592044-31592066 CTAGCTCAGTGTCATGCTGATGG - Intergenic
1108390014 13:49937648-49937670 CCAGATCAGTTTCATCCTGAAGG + Intergenic
1118375588 14:65174335-65174357 TTGCCTCTGTGACATCCTGAGGG - Intergenic
1121520762 14:94584765-94584787 TCAGCTCAGTGTGACCCTGTGGG + Intronic
1122164052 14:99807818-99807840 TCACCTTAGTGTTGTCTTGATGG + Intronic
1122165135 14:99817584-99817606 TGACCTCAGGGACTTCCTGAAGG + Intronic
1124171091 15:27374726-27374748 ACACCTCAGAGTTATCCTGATGG + Intronic
1126070975 15:44864472-44864494 TGGCCTCAGTGTCTGCCTGATGG + Intergenic
1127066660 15:55247081-55247103 AAGTCTCAGTGTCATCCTGAAGG - Intronic
1127906389 15:63379506-63379528 AGGCCTCAGTGGCATCCTGAGGG + Intronic
1130901101 15:88207249-88207271 TCCCCGCAGTGCCATCCTGGAGG - Intronic
1131861830 15:96661928-96661950 TCACCATCCTGTCATCCTGATGG + Intergenic
1131923655 15:97357948-97357970 TGAACTCAGAGGCATCCTGAAGG - Intergenic
1132179376 15:99740855-99740877 TCACCTCACAGACATCCAGAGGG + Intergenic
1133327604 16:4951405-4951427 TAACCATAGTGTTATCCTGAAGG - Intronic
1133966700 16:10536976-10536998 ACATCTCAGGGTCATCCTGAGGG + Intronic
1134174179 16:11992605-11992627 ACACCACACTGTCATCCTGGTGG - Intronic
1138494217 16:57397517-57397539 TGACCTCAGCGTCTGCCTGACGG + Intergenic
1140440134 16:74981481-74981503 TCACCTCAGCCTCAACCTTATGG - Intronic
1141722847 16:85766370-85766392 TAACCCCAGTGTCACCCTTAGGG - Intergenic
1142319470 16:89371751-89371773 TCTCCTCTCCGTCATCCTGAGGG - Intronic
1148249639 17:46065048-46065070 TCACTGCAGTGTCAACCTGGTGG + Intronic
1149334881 17:55625560-55625582 TCTCCTCAGGGTCATCTAGAAGG - Intergenic
1150289154 17:63971723-63971745 GGACTTCAGTGTCATCATGATGG - Exonic
1152710352 17:81868112-81868134 TCACCTCAGTACCATCCAGGAGG - Exonic
1152883995 17:82837627-82837649 AGACCTCGGTGTGATCCTGAAGG + Intronic
1157741426 18:50096800-50096822 TCTCCCCAGTGTCTTCCTGCTGG + Intronic
1157910959 18:51617082-51617104 TCACCTAAGTGCCACCCTGATGG - Intergenic
1159381892 18:67670744-67670766 TTACCTCAGTTTCATCCCTAAGG - Intergenic
1164435342 19:28223858-28223880 TCACCTCTGTATCATACTCATGG - Intergenic
1165443358 19:35843552-35843574 TCACCTCAGTGGGGTCCTGGAGG + Exonic
1165934890 19:39383355-39383377 GCAACTCAGAGTCATCCTGAGGG + Intronic
1166809369 19:45506681-45506703 TCACCTCCGGGCCCTCCTGAGGG + Intronic
1167563045 19:50237993-50238015 ACACCTCAGTGTCACCCACAGGG + Intronic
926337994 2:11878819-11878841 CCACTTCAGTGTCTTCCTGATGG + Intergenic
926833278 2:16988628-16988650 TCAATTCAGTGTCATACTGGAGG + Intergenic
928370895 2:30739469-30739491 TTTCCTCAGGGGCATCCTGAGGG - Intronic
928753467 2:34496835-34496857 TCACCTCTTTGTCATCCTCAAGG + Intergenic
929387639 2:41429221-41429243 GCTCCTCAGTGTGATTCTGATGG - Intergenic
929545858 2:42854951-42854973 TCAGCTCCGGTTCATCCTGAGGG + Intergenic
931376523 2:61713161-61713183 TCCCCTCAGAGTCATTGTGAAGG + Intergenic
934157619 2:89218165-89218187 TGACTTCATTGTCATCCTCAGGG - Intergenic
934164633 2:89282851-89282873 TGACTTCATTGTCATCCTCAAGG - Intergenic
934165820 2:89293283-89293305 TGACTTCACTGTCATCCTCAGGG - Intergenic
934201457 2:89889173-89889195 TGACTTCACTGTCATCCTCAGGG + Intergenic
934202641 2:89899673-89899695 TGACTTCATTGTCATCCTCAAGG + Intergenic
934209646 2:89964261-89964283 TGACTTCATTGTCATCCTCAGGG + Intergenic
934626344 2:95858380-95858402 TCACCTCAATCTCATCCAAAGGG + Intronic
934807217 2:97242936-97242958 TCACCTCAATCTCATCCAAAGGG - Intronic
934830290 2:97514251-97514273 TCACCTCAATCTCATCCAAAGGG + Intronic
936934433 2:117825581-117825603 TTACCTTAGGGTCATCCGGAGGG - Exonic
937347499 2:121135444-121135466 TCAGCTCAGGATCATCCTGCTGG - Intergenic
937735630 2:125284604-125284626 TCACCTCACTGGCAGCTTGAGGG - Intergenic
942248955 2:174031737-174031759 TCCCTTCAGTGTCAACCTTATGG - Intergenic
943821397 2:192327205-192327227 TCCCCTCAGGGTAATCCTAAGGG + Intergenic
944201274 2:197109878-197109900 TGACTTCAGTGACAACCTGATGG + Intronic
944523668 2:200596974-200596996 ACACCTCACTGTCACGCTGATGG - Intronic
948922231 2:241071192-241071214 TCTCCCCAGTGGCCTCCTGATGG - Intronic
1171015023 20:21532807-21532829 TCACCTCAGTTTAAGCCTGGTGG - Intergenic
1171056266 20:21909724-21909746 ACACCTCAGTGTCATCCATCTGG - Intergenic
1172192146 20:33068632-33068654 ACACCTGAGTGTCAGCCTCATGG + Intronic
1172565710 20:35928793-35928815 TCACATCACTGCCATCCTGAAGG + Intronic
1172799660 20:37566984-37567006 TCACCTGGGGGTCATCCTGTAGG + Intergenic
1174455722 20:50647404-50647426 TCACCTCTGTGTCAGTCTGTGGG - Intronic
1174585790 20:51607158-51607180 TTACCTCAGTGGCCTCCAGAGGG - Intronic
1175656778 20:60777939-60777961 TCATCTTTGTGTCATCCTCAAGG - Intergenic
1177552864 21:22648320-22648342 AAACTTCAGTGTCATCCTCATGG - Intergenic
1178544600 21:33482071-33482093 TCACTGCAGTGTAATCCTGCAGG + Intergenic
1183053813 22:35288389-35288411 TCACCTCAGTTTCCTGCAGACGG - Exonic
1184567284 22:45299571-45299593 TTATTTCAGTGTCATCCTGTGGG + Intergenic
951629149 3:24699547-24699569 TCAGCTCAGTGTCTGCCTAAAGG + Intergenic
951711955 3:25592241-25592263 CCACCTCAGTGTCAACCTACAGG - Intronic
952072128 3:29650008-29650030 TCACCACAATTGCATCCTGAGGG - Intronic
955870071 3:63428734-63428756 TCTCTTCAGTGTCATCCAGCAGG + Intronic
956146951 3:66199776-66199798 TCAACTCAGGGTCATGATGAGGG - Intronic
957687772 3:83525021-83525043 ACTCCTCAGTGTCACCCTGCTGG - Intergenic
958869257 3:99537866-99537888 TCCCCTCACTTTCATCCTGTGGG - Intergenic
959884849 3:111487864-111487886 GCACCTTAGTTTCTTCCTGAGGG - Intronic
960122606 3:113962606-113962628 TCAACTCATTGTGATCCTAATGG + Exonic
960510701 3:118545531-118545553 TGACCTGAGTGTTATCCTGGAGG + Intergenic
960725988 3:120670609-120670631 TGACTTGAGTGTCTTCCTGATGG - Intronic
965550151 3:169956235-169956257 GCACCTGAGTGTCACCCAGATGG - Intergenic
967669947 3:192220988-192221010 TCACCTCTTTGTCATTCAGATGG - Intronic
973112716 4:46415199-46415221 TCAAAGCAGTGTCTTCCTGAGGG + Intronic
977765014 4:100787082-100787104 CAACCTCAGGTTCATCCTGATGG + Intronic
978846702 4:113281607-113281629 TCCCTTCAGTGACATGCTGAAGG - Intronic
980880642 4:138706902-138706924 ACACCTCAGAATAATCCTGAAGG - Intergenic
981822651 4:148903587-148903609 GCTCCTCAGTGTCATCCAGTGGG + Intergenic
982063585 4:151629601-151629623 TCACCACAGTGACATCATCAAGG - Intronic
982668112 4:158291347-158291369 CCACCTGAGGGTCATCATGACGG + Intergenic
984163995 4:176286226-176286248 TCCCCTCTGTGTCCTCCAGAGGG - Intergenic
988691583 5:33577813-33577835 ATACCTCAGTGCCATGCTGAGGG - Intronic
989108878 5:37888385-37888407 TCAGCACAGTCACATCCTGAGGG + Intergenic
990818153 5:59808210-59808232 TCAGCCCAGTGACATCCTGTGGG + Intronic
992003054 5:72453715-72453737 TCCCATCAGTGTCACCCTGCTGG - Intronic
992192959 5:74312220-74312242 TCCCCTCACTGTCTTCCTGGCGG - Intergenic
993040060 5:82804281-82804303 TCTCCTCAGTGTAATCCCTATGG + Intergenic
994053735 5:95391924-95391946 TCACCTCACTGTCTTCCACATGG - Intronic
997677976 5:135728793-135728815 TCACCTCAGTTTCATCCTCTTGG + Intergenic
1003899542 6:10641393-10641415 GCCCTTCAGTGTCACCCTGATGG + Intergenic
1004258318 6:14085206-14085228 TCCCCTCATTGTTCTCCTGAGGG - Intergenic
1005845258 6:29772013-29772035 AAAACTCAGTGTCATCCTGGAGG + Intergenic
1007660681 6:43483952-43483974 CCACCTCAGCCTCCTCCTGAGGG - Intronic
1011618076 6:89216227-89216249 GCACCTCAGTGTCCTCCTTCTGG - Intronic
1016906437 6:149155101-149155123 TCACCTCACTGTCTGCCAGAAGG - Intergenic
1016980307 6:149847513-149847535 TCTCTCCAGTGTCATCCTAATGG - Intronic
1017142492 6:151204416-151204438 TCAGCTCAGTGGTATCCTCATGG + Intergenic
1018572375 6:165224987-165225009 TCACTTCAGTTACAGCCTGAAGG + Intergenic
1019444188 7:1062655-1062677 ACACCTCAGTTCCATCCTCAGGG - Intronic
1019471438 7:1223626-1223648 TCACCTGAGTGTCATCCTACAGG - Intergenic
1020917438 7:14213637-14213659 CCCCCTTAGTGTCATCCTGTGGG + Intronic
1026012453 7:66647279-66647301 TCTGCTCAGTGTGATCCTGCAGG - Intronic
1026888524 7:73968720-73968742 TCACTGCAGTGTCAGCCTGCTGG + Intergenic
1028332729 7:89616269-89616291 ACACCTTACTGTCCTCCTGATGG + Intergenic
1028370549 7:90087184-90087206 CCACCTCAGTGTTTTCCTGGTGG + Intergenic
1032282653 7:130517019-130517041 TCACCTGTGTGTCATTCTTAGGG - Intronic
1035567879 8:653781-653803 TCTCCTCAGTGCCACCCTGCGGG - Intronic
1036409069 8:8481664-8481686 TTACATCAGTGTCACCTTGATGG - Intergenic
1037416265 8:18653455-18653477 ACATTTCAGTGTCATCCTGAAGG + Intronic
1038617157 8:29105399-29105421 GGACCTCAGTGTCATCCTTCAGG + Intronic
1039757070 8:40535280-40535302 TCCCCTTATTCTCATCCTGAAGG + Intronic
1039912245 8:41834645-41834667 TCACCATAGTGAGATCCTGAAGG + Intronic
1040984854 8:53282248-53282270 TAACATCTGTGTCATCCAGAAGG - Intergenic
1044802848 8:95974953-95974975 TGAGCTCAGTGTAATCATGAGGG + Intergenic
1045427658 8:102083124-102083146 TAACCTCAGTGTCTTCCCCATGG + Intronic
1047807495 8:128375539-128375561 TGGCCTCAGTGTCTGCCTGATGG - Intergenic
1050352347 9:4752448-4752470 TTACCTCAGTTTCATTCTTAAGG - Intergenic
1050873647 9:10608736-10608758 TCACATCAGTGTTCTCCTAACGG + Intronic
1051069586 9:13148542-13148564 TCATCTAAGTATCAACCTGAGGG - Intronic
1059236971 9:112769373-112769395 TCACTGCAGTGCCATCCTGCAGG + Intronic
1060212882 9:121721229-121721251 TCACCCCAGTGTCTTGCTGCAGG + Intronic
1060667545 9:125441288-125441310 TTAGCTCAGTGACATCTTGATGG + Intronic
1060794184 9:126503557-126503579 TCACCACGGAGTCACCCTGAGGG + Exonic
1062243743 9:135552911-135552933 TCTCCTTAGTGTCAGCATGAGGG - Intergenic
1193773883 X:85620174-85620196 TCACCTCTGTGGCATGCTGGAGG - Intergenic
1194234202 X:91361987-91362009 CCACCTGACTGTCAACCTGATGG + Intergenic
1195805322 X:108759182-108759204 TCACTGCAGTGTCAACCTCACGG + Intergenic
1195906947 X:109853415-109853437 TCACTGCAATGTAATCCTGAAGG - Intergenic
1197768497 X:130074251-130074273 TCACTTCAGGGTCAGCCCGAAGG - Intronic
1198030934 X:132752775-132752797 TCTCCTCACTGTCTTCCTCAGGG - Intronic
1198361372 X:135898562-135898584 TCACCACACTGTCATCCACATGG + Intronic
1199555872 X:149108121-149108143 CCAGTTCAGTGTCATCCTGTGGG - Intergenic
1199952215 X:152715502-152715524 TCAACTCTCTGTCACCCTGAAGG - Intronic
1199957468 X:152752946-152752968 TCAACTCTCTGTCACCCTGAAGG + Intronic
1201909115 Y:19115261-19115283 TCACCTCAGTGACTTCCACAAGG + Intergenic