ID: 1086607158

View in Genome Browser
Species Human (GRCh38)
Location 11:88709585-88709607
Sequence TCACCTCAGTGTCATCCTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 190
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 174}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1086607149_1086607158 29 Left 1086607149 11:88709533-88709555 CCAACCCACCTCTCTGAAGTGAA 0: 1
1: 0
2: 0
3: 16
4: 208
Right 1086607158 11:88709585-88709607 TCACCTCAGTGTCATCCTGAGGG 0: 1
1: 0
2: 0
3: 15
4: 174
1086607152_1086607158 21 Left 1086607152 11:88709541-88709563 CCTCTCTGAAGTGAACTAATCAA 0: 1
1: 0
2: 0
3: 16
4: 170
Right 1086607158 11:88709585-88709607 TCACCTCAGTGTCATCCTGAGGG 0: 1
1: 0
2: 0
3: 15
4: 174
1086607151_1086607158 24 Left 1086607151 11:88709538-88709560 CCACCTCTCTGAAGTGAACTAAT 0: 1
1: 0
2: 0
3: 26
4: 304
Right 1086607158 11:88709585-88709607 TCACCTCAGTGTCATCCTGAGGG 0: 1
1: 0
2: 0
3: 15
4: 174
1086607150_1086607158 25 Left 1086607150 11:88709537-88709559 CCCACCTCTCTGAAGTGAACTAA 0: 1
1: 0
2: 0
3: 19
4: 202
Right 1086607158 11:88709585-88709607 TCACCTCAGTGTCATCCTGAGGG 0: 1
1: 0
2: 0
3: 15
4: 174

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086607158 Original CRISPR TCACCTCAGTGTCATCCTGA GGG Intronic