ID: 1086609438

View in Genome Browser
Species Human (GRCh38)
Location 11:88736893-88736915
Sequence CAGCACGGGAAACTTAGCAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 76
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 74}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1086609438_1086609445 27 Left 1086609438 11:88736893-88736915 CCTATGCTAAGTTTCCCGTGCTG 0: 1
1: 0
2: 0
3: 1
4: 74
Right 1086609445 11:88736943-88736965 CCAAGTCTGTCCCTTCATCTAGG 0: 1
1: 0
2: 2
3: 30
4: 205

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086609438 Original CRISPR CAGCACGGGAAACTTAGCAT AGG (reversed) Intronic
904200990 1:28818910-28818932 CAGCACGCCAACCTTACCATGGG - Intronic
913714762 1:121522275-121522297 CAGAGCGGGAAATTTGGCATTGG + Intergenic
914711097 1:150214447-150214469 CAGCCCAGGAAGCTTAGCAGTGG + Intergenic
916007468 1:160675374-160675396 CAGCATGGGACCCCTAGCATAGG + Intergenic
920714172 1:208323988-208324010 CAGCACTGGAAACTTTGCTGAGG - Intergenic
923104617 1:230844427-230844449 CTGCACAGGAAACATGGCATCGG - Intronic
923603160 1:235421158-235421180 CAGCATGGTAATCTCAGCATTGG + Intronic
1063037904 10:2305732-2305754 CACCACTGGAGGCTTAGCATTGG + Intergenic
1065645874 10:27833415-27833437 CAGCACGGAAAATACAGCATTGG + Intronic
1069943495 10:71970813-71970835 CATAACGGGAAAATTAGCTTTGG - Intronic
1073073095 10:100807165-100807187 CAGCCCAGGACACATAGCATGGG + Intronic
1080389284 11:31829220-31829242 CAGCAAGGGAAGCAGAGCATAGG - Intronic
1081584835 11:44377078-44377100 GATCTCGGGAAACGTAGCATGGG + Intergenic
1086609438 11:88736893-88736915 CAGCACGGGAAACTTAGCATAGG - Intronic
1090518997 11:127458781-127458803 CAGCAGGGGAGACTGGGCATTGG + Intergenic
1091149508 11:133314521-133314543 CAGCATGGAAAACATAGCAGAGG - Intronic
1096360443 12:50980935-50980957 CAGCACGGAAAACTGATCACTGG + Intronic
1096509843 12:52121642-52121664 CAGCACGGGTAAGGGAGCATGGG - Intergenic
1098661612 12:73101406-73101428 CTGCACAGGCAACTTAGAATAGG - Intergenic
1101108666 12:101464145-101464167 CAGCCCGGGCAACATAGCTTGGG - Intergenic
1110287893 13:73771162-73771184 TGGCACGGGGTACTTAGCATGGG + Intronic
1110614700 13:77528700-77528722 CAACACGGGGAACTTATGATGGG + Intergenic
1111279211 13:85997285-85997307 CAGCACTTGAAACTTGTCATAGG + Intergenic
1113526246 13:110980168-110980190 CTGCACGGCAAACATACCATGGG - Intergenic
1121414813 14:93772091-93772113 CAGTACTGGAAACTAAGTATTGG + Intronic
1122957252 14:105076534-105076556 CAGGACGGGAAGCTTTGCAGAGG + Intergenic
1129163069 15:73758241-73758263 CAGAACGAGAAACTTAGGCTTGG - Intergenic
1129272239 15:74425060-74425082 CAGCAGGGGAGACTGAGCAAGGG + Intronic
1129597927 15:76979384-76979406 CAGCTCGGACAACTTGGCATTGG + Intergenic
1133133124 16:3690521-3690543 CGGGAGGGGAAACTCAGCATTGG - Intronic
1136279320 16:29198758-29198780 CAGCACGGGACACTTCCCGTGGG + Intergenic
1162769555 19:12940847-12940869 CAGCACGCCAAAGTTATCATAGG - Exonic
925662208 2:6214171-6214193 CTGCACGGTATACTTAGCACTGG - Intergenic
926788653 2:16546908-16546930 CAGAAAAGGAAAGTTAGCATGGG + Intergenic
928841164 2:35606420-35606442 CAGCTCGGGATTCTTTGCATAGG + Intergenic
940454737 2:153882457-153882479 CAGCAAGGGCAACTAAGGATGGG + Intronic
1168974505 20:1954002-1954024 CAGCACTGGAAACACATCATGGG + Intergenic
1170067537 20:12330250-12330272 CTTCATGGTAAACTTAGCATTGG + Intergenic
1171987587 20:31671226-31671248 CAGCAGTGGAAACGTAGAATGGG - Intronic
1176869205 21:14072917-14072939 CAGCACGGGAAAGAAAGCAGTGG - Intergenic
950185138 3:10940125-10940147 CAGGACGGGAAGCCTAGCCTGGG + Exonic
950357758 3:12425922-12425944 CACCAGTGGAAACTGAGCATGGG - Intronic
956901815 3:73724652-73724674 CAGCACAGGAAACATAGCTCTGG + Intergenic
957657357 3:83097451-83097473 CAGCATGGGAAACTTGGACTTGG + Intergenic
965697786 3:171427469-171427491 CAGCTGAGGAAACTGAGCATTGG - Intronic
968661679 4:1801253-1801275 CAGGACGGGAAACTGAGGCTGGG + Intronic
974017164 4:56657797-56657819 CAGCCCAGGAAAATGAGCATAGG + Exonic
974936038 4:68410824-68410846 CAGCAAGGCAATCTGAGCATAGG - Intergenic
977378947 4:96245348-96245370 CAAAACGGGAAACTTAGATTTGG - Intergenic
979350901 4:119643424-119643446 CAGCAAGGGAAATCTAGCATGGG + Intergenic
981645792 4:146997308-146997330 CTGCAGGGGAAACTTTGAATGGG - Intergenic
992924686 5:81569563-81569585 CAGCAGTGGAAGCTCAGCATAGG - Intronic
994057100 5:95429367-95429389 GAGCACAGAAAACTTTGCATTGG - Intronic
998474606 5:142409623-142409645 CTACACAGGAACCTTAGCATGGG + Intergenic
999335322 5:150711165-150711187 CAGCATGTGGAACTTAGCTTGGG - Exonic
1003472971 6:6453930-6453952 CTGCAAGGGAAGCTTAGGATAGG - Intergenic
1005587572 6:27291725-27291747 CAGCGATGGAAACTAAGCATGGG + Intronic
1007433026 6:41787339-41787361 CAGCAGGGGAAGCGTAGCTTTGG - Exonic
1010076789 6:71807942-71807964 CAGTACTGTAAACCTAGCATTGG - Intergenic
1020181246 7:5924142-5924164 TAGCACAGGAAACTTGGCAATGG + Intronic
1020301687 7:6800746-6800768 TAGCACAGGAAACTTGGCAATGG - Intronic
1021621234 7:22552758-22552780 CAGCAGGGGAAACTTAGGCAAGG + Intronic
1023315142 7:38928678-38928700 GAGGACAGGGAACTTAGCATTGG - Intronic
1032709750 7:134451360-134451382 CAGCACGGGACTCTAAGCAATGG + Intronic
1037047266 8:14322717-14322739 AAGCAAGTGAAACTAAGCATAGG - Intronic
1037241285 8:16781398-16781420 CAGCAAGTGAAACATATCATTGG + Intergenic
1045825018 8:106386796-106386818 AAGCAGGGGAAAATAAGCATGGG + Intronic
1047258570 8:123235688-123235710 CAGCACCGGAGACCTGGCATCGG + Intronic
1047995481 8:130331027-130331049 CAGCTGGGGGAACTGAGCATTGG - Intronic
1055604071 9:77949614-77949636 CAGCTCTGGAAAATTGGCATAGG + Intronic
1060401794 9:123353913-123353935 CAGCACTGCAAAGTCAGCATTGG - Intergenic
1061114292 9:128598981-128599003 CAGCACCCGAAACTTACCCTGGG - Exonic
1061756544 9:132816587-132816609 CAGAACTGGAAGCTAAGCATGGG - Intronic
1192305906 X:69959244-69959266 CTGCATGAGAAACTTGGCATTGG - Intronic
1193165123 X:78271257-78271279 CAGCAAGGGAAAAATAGTATAGG + Intergenic
1197656624 X:129123588-129123610 CAGCACAGGAAACTGAGAAATGG + Intergenic