ID: 1086611195

View in Genome Browser
Species Human (GRCh38)
Location 11:88757810-88757832
Sequence GAGGTGCCAAAGCATTTTGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 120
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 106}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1086611195_1086611196 -8 Left 1086611195 11:88757810-88757832 CCTACAAAATGCTTTGGCACCTC 0: 1
1: 0
2: 0
3: 13
4: 106
Right 1086611196 11:88757825-88757847 GGCACCTCCCATTGATGTTTAGG 0: 1
1: 0
2: 0
3: 5
4: 76
1086611195_1086611203 17 Left 1086611195 11:88757810-88757832 CCTACAAAATGCTTTGGCACCTC 0: 1
1: 0
2: 0
3: 13
4: 106
Right 1086611203 11:88757850-88757872 CCAGTGGTCCAAGAGCACCATGG 0: 1
1: 1
2: 7
3: 22
4: 340
1086611195_1086611197 -7 Left 1086611195 11:88757810-88757832 CCTACAAAATGCTTTGGCACCTC 0: 1
1: 0
2: 0
3: 13
4: 106
Right 1086611197 11:88757826-88757848 GCACCTCCCATTGATGTTTAGGG 0: 1
1: 0
2: 0
3: 5
4: 66
1086611195_1086611201 1 Left 1086611195 11:88757810-88757832 CCTACAAAATGCTTTGGCACCTC 0: 1
1: 0
2: 0
3: 13
4: 106
Right 1086611201 11:88757834-88757856 CATTGATGTTTAGGGACCAGTGG 0: 1
1: 0
2: 2
3: 16
4: 200

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086611195 Original CRISPR GAGGTGCCAAAGCATTTTGT AGG (reversed) Intronic
900733854 1:4282296-4282318 GAGATGTCCAAGCATCTTGTGGG + Intergenic
907897281 1:58703671-58703693 GAGATCCCACAGCAGTTTGTAGG - Intergenic
909341027 1:74531189-74531211 CAAGTGCCAAAGCATTTAATGGG - Intronic
910731084 1:90397868-90397890 GAGGTCCCAAAGCAATTTAGTGG - Intergenic
911380984 1:97114329-97114351 GTGGTGCTAAAGAATTTTTTAGG + Intronic
912965790 1:114236091-114236113 GATTTGCCAGAGCAGTTTGTAGG - Intergenic
913313707 1:117532056-117532078 AAGGTGCCAAAGCAATTTATAGG - Intergenic
917182107 1:172309982-172310004 GAGGGCACAAAGCATATTGTGGG - Intronic
923311636 1:232741197-232741219 GAGGTACCAAAGCGTTGTGTAGG - Intergenic
924062862 1:240194458-240194480 GAGGTGACCAAGCATTTTAAAGG + Intronic
1063605922 10:7522795-7522817 GTGGTGCCAAAAGATTTAGTGGG + Intergenic
1063708016 10:8449801-8449823 GAGTTGCCAGATGATTTTGTAGG + Intergenic
1066618224 10:37317669-37317691 CAGGTCCCAAAGAATGTTGTAGG - Intronic
1078889220 11:15539010-15539032 GAGGGACCAAAGCATCTTGTTGG + Intergenic
1079603391 11:22338573-22338595 GAGGGGCTAAAGAATTTTGCTGG + Exonic
1080266827 11:30409784-30409806 TGGTTGCCACAGCATTTTGTGGG + Intronic
1085936011 11:81144059-81144081 GTGGGGACAAAGCATTTTGGAGG + Intergenic
1086611195 11:88757810-88757832 GAGGTGCCAAAGCATTTTGTAGG - Intronic
1087448602 11:98288010-98288032 TATGTGCAGAAGCATTTTGTTGG - Intergenic
1090989929 11:131807723-131807745 CAGGTGCCAAAGACTTTTCTAGG - Intronic
1092173743 12:6389314-6389336 GAGTTGCCAAAGCATGCGGTGGG + Intronic
1101463315 12:104920081-104920103 GAGGTGCCAAAGCAATTCAGTGG - Intronic
1102381417 12:112469903-112469925 GAGATGCCAAAGCATCTTGAAGG + Intronic
1103029217 12:117599069-117599091 GAGAGGCCAAATCATTTTCTAGG - Intronic
1105836637 13:24217845-24217867 GAGTTGCCACAGTATTTTGTGGG - Intronic
1109824159 13:67696245-67696267 GAGTTGCAAAAGAATTGTGTGGG + Intergenic
1110399631 13:75074693-75074715 GAGGTGGCAAGGTATTTTGGGGG - Intergenic
1115375947 14:32675322-32675344 AAGTTGCCAAAGTATTTTGATGG + Intronic
1116310231 14:43316265-43316287 AATTTGCCAAAGCATTTTCTCGG - Intergenic
1121418030 14:93792655-93792677 GAGATGCCAGAACATTTTTTTGG + Intergenic
1126131571 15:45347072-45347094 AAGATGCCACAGCATTTGGTAGG - Intergenic
1126493659 15:49266725-49266747 ATGGTGATAAAGCATTTTGTTGG + Intronic
1127161205 15:56188628-56188650 GAGGTACCAAAGCAATTCGAGGG + Intronic
1127202379 15:56669745-56669767 GAAGTGCCTTAGCATTTTTTTGG - Intronic
1128494978 15:68192519-68192541 TAGGAGCCAAAGAGTTTTGTGGG - Exonic
1132345210 15:101103913-101103935 AAGGTGCAAATGCAATTTGTGGG - Intergenic
1138761950 16:59555226-59555248 GAGGTGGTAAAGCAGTATGTAGG - Intergenic
1141122839 16:81374846-81374868 GAGGTGCCAAGGCAATTTAGTGG + Intronic
1141380569 16:83572749-83572771 GAGTTTCCAAAGCATATTTTGGG - Intronic
1144293439 17:13849721-13849743 AAGGTGACAAACCATTTTGCAGG - Intergenic
1144484035 17:15650334-15650356 GAGGTGCCAAACCAATTTCCAGG + Intronic
1144790715 17:17857267-17857289 GAGGTTTCAAATCATTTTGACGG + Intronic
1146403462 17:32518521-32518543 CAGGTCCCAAAGCATTTAGAGGG + Intronic
1147473001 17:40681631-40681653 GTTGTGCCAAAACATTTCGTTGG + Intergenic
1148221890 17:45868839-45868861 GAGGTGCTATAGCATCTAGTGGG + Intergenic
1149475558 17:56958040-56958062 GACCAGCCAAAGCATTCTGTTGG - Intronic
1155009056 18:21757033-21757055 GAGCTGCTAAAGGATTATGTAGG - Intronic
1155689845 18:28606220-28606242 AAGTTGCCAAAGCATTTCGATGG - Intergenic
1158348710 18:56541972-56541994 GTGGTGCTTAAGCAGTTTGTGGG - Intergenic
1163472996 19:17508315-17508337 GAGGTGACAGAGCATTTGCTGGG + Intergenic
1164938389 19:32232166-32232188 GAGGTGAAAGAGCATTTTGCTGG + Intergenic
1165221285 19:34318607-34318629 GAGCTGCAAAAGGTTTTTGTTGG + Intronic
1165347455 19:35257816-35257838 GATGTGCCAAAACACTTTGATGG + Intronic
1167882634 19:52473782-52473804 AATGTGCCAAAGAATTTGGTGGG - Intronic
1168544887 19:57241958-57241980 GAGGTCTTAAAGGATTTTGTGGG + Intronic
925901761 2:8513967-8513989 GACGTGCCACTGCATTTTATAGG + Intergenic
934907531 2:98218246-98218268 GAGATGCTAAAGCAGGTTGTAGG + Intronic
935535595 2:104290001-104290023 GTGGTGCCCAAGCATCTTGGAGG - Intergenic
938678789 2:133667417-133667439 GAGGACCCAAACCAATTTGTTGG - Intergenic
939648010 2:144724941-144724963 GACCTCCCAAATCATTTTGTGGG + Intergenic
940031122 2:149262477-149262499 GAGGTTCTAATACATTTTGTAGG + Intergenic
940714717 2:157207657-157207679 AAGGTGCCAAAGTAATTTATTGG - Intergenic
944766189 2:202866492-202866514 GAGGTGCCAAAGCAATTCATTGG + Intronic
945582050 2:211607693-211607715 GAGATGCAATAGCATTTTTTGGG + Intronic
947390880 2:229638432-229638454 AAGGTGCCAAAGCAATTTATGGG + Intronic
947802391 2:232938256-232938278 GAATTTCCAAAGCATTTTGATGG + Intronic
1170641604 20:18158978-18159000 GAGGTGCCATTGCATGTTGCAGG + Intronic
1171946281 20:31380690-31380712 GAGGTGCAAAAGCAATTCATTGG - Intronic
1172330668 20:34074220-34074242 GAGGTGCCCAAGCAGCTGGTAGG + Intronic
1184065249 22:42115170-42115192 GGGGTGACAAAGCATTTCCTTGG - Intergenic
952828996 3:37547459-37547481 ATGGTCCCAAGGCATTTTGTTGG - Intronic
955370907 3:58350983-58351005 GGGCTGCTAAAGCATTTAGTGGG - Intronic
955997186 3:64688839-64688861 GAGGGTCCATAGCATTCTGTAGG + Intergenic
959378169 3:105610329-105610351 GAGGTGAAAAATTATTTTGTGGG - Intergenic
959775803 3:110161646-110161668 AAGGTGACAAAGAATTTTGTGGG + Intergenic
961726410 3:128933789-128933811 GTGGTGCCACAGCATTTGGAAGG - Intronic
962402818 3:135075852-135075874 CAGGTGCCAAGACATTTTCTGGG - Intronic
963241834 3:143011533-143011555 GAGGTACAAAAGCATTTGGTGGG + Intronic
964438119 3:156675042-156675064 GAGGCGCCGAAGGATTTAGTTGG + Exonic
972515647 4:39808435-39808457 GAGGTGCCCAAGCACTTCCTAGG + Intergenic
975724519 4:77278971-77278993 GAGGTTACAAAGCATGTTGAGGG + Intronic
976631528 4:87242313-87242335 GAGGTGCCACATTACTTTGTTGG + Intergenic
976845792 4:89487602-89487624 AAGCAGCCAAAGCATTTTGCGGG + Intergenic
986138622 5:5007419-5007441 AAGGTGCCAAGGCATTTTCTTGG - Intergenic
986556189 5:9011782-9011804 GAGTTCCCAAAGCATTTTACTGG - Intergenic
991396078 5:66206657-66206679 GAGGAGGAAAAGGATTTTGTTGG + Intergenic
991725424 5:69531097-69531119 GAAGTGACAGATCATTTTGTAGG - Intronic
995430484 5:112069612-112069634 GAGGTCCCAGAGAACTTTGTAGG - Intergenic
1000066812 5:157700442-157700464 GAGGTGCAAAACCATTTTTTTGG + Intergenic
1000382607 5:160642532-160642554 GGGGTGCTAATGCATCTTGTGGG + Intronic
1001213742 5:169835623-169835645 GAAGTACCAAAGCATATTATTGG + Intronic
1008779114 6:55080781-55080803 GAGGGGCCACAGCATGTTCTGGG + Intergenic
1009440145 6:63668307-63668329 GAGGTGGCAAATAATTTTTTTGG + Intronic
1010267299 6:73881462-73881484 GAGGTGCCATTGCATTTTTAAGG + Intergenic
1015731609 6:136353867-136353889 GAGGGGCAAAAGCATTTAGGTGG + Intronic
1015787588 6:136933661-136933683 GAAGTGACAAAGAATTATGTTGG - Intergenic
1017700089 6:157061000-157061022 GAGGTGCCACAGCAGGTTGTGGG - Intronic
1027048780 7:75008401-75008423 GATGTTCTAAAGCACTTTGTAGG - Intronic
1028354786 7:89893369-89893391 GAAGTGCCAAAGCAATTCTTTGG - Intergenic
1034595580 7:152187770-152187792 CAGGTGGCAAAGAATTATGTGGG + Exonic
1036028184 8:4934263-4934285 ATGGTCCCAAAGCATTCTGTGGG - Intronic
1038567354 8:28630807-28630829 GAGGTGTCAAAGAACTTTGCTGG + Intronic
1040822756 8:51583116-51583138 AAGGTGCCAAAATATTTTTTAGG + Intronic
1041610266 8:59838362-59838384 CAGGTGCCAAGGGATTTTGGGGG - Intergenic
1044017714 8:87065543-87065565 GAGGAACCAAACCAATTTGTGGG + Intronic
1049362206 8:142217426-142217448 GAGGGGCCCAAGCCTCTTGTGGG - Intronic
1051112914 9:13660650-13660672 GAGTAGCCTAAGCATTTTCTGGG + Intergenic
1053326766 9:37160541-37160563 AAGGTCCTAAAGCATTATGTGGG + Intronic
1055896044 9:81176985-81177007 CAGGTGCCAAGGGATTTTCTTGG + Intergenic
1060017007 9:120095541-120095563 GGGCTTCCAAAGCATTTTATGGG - Intergenic
1060433873 9:123576042-123576064 GAAGGTCCAAAACATTTTGTGGG - Intronic
1186602720 X:11055741-11055763 GAGGTGCCAAGGAATCTTGCTGG + Intergenic
1189200862 X:39194633-39194655 CAGGTGACAAAGCATTTGGCTGG + Intergenic
1191915076 X:66192483-66192505 CAGGTAGCAAAGCTTTTTGTGGG + Intronic
1195708670 X:107757041-107757063 GAGGGACCAAAGCATTCTGTGGG + Intronic
1196584175 X:117409853-117409875 TTCATGCCAAAGCATTTTGTAGG - Intergenic
1198096731 X:133387318-133387340 AATGTCCCAAAGCATTTTGCAGG + Intronic
1198851634 X:140970519-140970541 GAGCTCCCAAATAATTTTGTAGG + Intergenic
1202127155 Y:21578737-21578759 CAGGTGCTGAAGCATTTTGGGGG - Intergenic
1202152101 Y:21852784-21852806 CAGGTGCTGAAGCATTTTGGTGG + Intergenic