ID: 1086613378

View in Genome Browser
Species Human (GRCh38)
Location 11:88784345-88784367
Sequence TCCACTTATGTGCCCACCAT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 278
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 262}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1086613376_1086613378 4 Left 1086613376 11:88784318-88784340 CCAGTAGGAAGCACACTTTTCCT 0: 1
1: 0
2: 3
3: 15
4: 199
Right 1086613378 11:88784345-88784367 TCCACTTATGTGCCCACCATAGG 0: 1
1: 0
2: 1
3: 14
4: 262

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086613378 Original CRISPR TCCACTTATGTGCCCACCAT AGG Intronic
900390996 1:2433856-2433878 TCCACGGATGTGCCCACACTGGG + Intronic
902262229 1:15235231-15235253 TCAACTTAGGTGCCCATCAATGG + Intergenic
904266541 1:29321558-29321580 TCCACTAAAGCGCCCATCATGGG + Intronic
904913916 1:33955908-33955930 TGCACTGGTGTGGCCACCATAGG - Intronic
905846630 1:41239595-41239617 TACACTTATGTACCTACTATGGG - Intronic
907660519 1:56388481-56388503 TCCACTTCTCTGCCAACCCTTGG + Intergenic
909053829 1:70799635-70799657 TCAACTTAGGTGCCCATCAGTGG + Intergenic
909190879 1:72549019-72549041 TCCATTCATGTGCCCCCAATTGG + Intergenic
912168779 1:107071885-107071907 TCCACTTCTCTGCCCTGCATAGG + Intergenic
916237328 1:162603400-162603422 TCCAGTTAGGTGCCCATCAAAGG - Intergenic
917093912 1:171381614-171381636 TCCACTTGTGGCCCCAGCATGGG - Intergenic
918110969 1:181455251-181455273 TGGACTTTTGTGCCCACCAGTGG - Intronic
919102948 1:193116483-193116505 TCTACTAATGAGCCCACCAAAGG - Intergenic
919358935 1:196565527-196565549 TCCACCTAGGTGTCCACCAATGG + Intronic
920080599 1:203370083-203370105 GCCTCTTATGTGCCAAGCATGGG + Intergenic
920595642 1:207267102-207267124 TCAACTTATGTGCCCATTAATGG + Intergenic
923465552 1:234245366-234245388 TCAACTTATGTGTCCATCAATGG - Intronic
924471810 1:244349384-244349406 TTCACTTATGTGCCAAGAATTGG - Intergenic
1064266381 10:13828856-13828878 TCCACTTAAGTGTCCATCAATGG - Intronic
1067154561 10:43766882-43766904 TCAACTTAGGTGCCCATCAGTGG + Intergenic
1067435052 10:46270728-46270750 TCCACCTATGGGACCACCATGGG + Intergenic
1068944497 10:62715868-62715890 TTAACTTATGTGCCCATCAATGG + Intergenic
1069079371 10:64071301-64071323 TCAACCTAGGTGCCCACCAGTGG - Intergenic
1070200424 10:74199586-74199608 TCAACTTAGGTGCCCATCAATGG - Intronic
1071943872 10:90618619-90618641 TCGACTTAGGTGCCCATCAATGG - Intergenic
1072047163 10:91668558-91668580 TCAACTTAAGTGCCCATCAATGG - Intergenic
1073534924 10:104268242-104268264 ACCACCTATGTGCCCAACATGGG - Intergenic
1075821171 10:125313341-125313363 TCAACTTAGGTGCCCATCAATGG + Intergenic
1077448771 11:2620587-2620609 TCCACTTAGATGCCCATCAGTGG - Intronic
1077680068 11:4231556-4231578 TCACCTAATGTGCCCACCTTTGG + Intergenic
1078024102 11:7678531-7678553 TCCACTTAGGTGCCCATCAGTGG + Intergenic
1078793210 11:14566022-14566044 TCCAGGTATGCTCCCACCATGGG - Intronic
1078912669 11:15747510-15747532 TTCACTTATGTGCCAGGCATTGG + Intergenic
1078956594 11:16203662-16203684 TACACTTTTGTTCCCTCCATTGG + Intronic
1079568063 11:21907678-21907700 TCCACTTATTTGCAGAGCATTGG - Intergenic
1081030077 11:38068891-38068913 TTCACTTATTTGTCCTCCATTGG + Intergenic
1082274764 11:50209349-50209371 TCCACCTAAGTGCCCATCAAGGG + Intergenic
1082813655 11:57494091-57494113 TACACCCATGTGACCACCATGGG - Exonic
1084340423 11:68495554-68495576 TCCATTTATATGCCCAGAATAGG - Intronic
1084434204 11:69129176-69129198 TCAACCTATGTGCCCATCAATGG + Intergenic
1084676226 11:70637035-70637057 CCCACATACGTGCCCACCAGAGG - Intronic
1085725492 11:78951244-78951266 ACCTCATCTGTGCCCACCATGGG - Intronic
1086051103 11:82591462-82591484 TCAACTTAAGTGCCTACCAATGG - Intergenic
1086613378 11:88784345-88784367 TCCACTTATGTGCCCACCATAGG + Intronic
1087425073 11:97975276-97975298 TCCACTGATGTGGCTACCCTCGG + Intergenic
1087586243 11:100125562-100125584 TCAACCTATGTGCCCATCAACGG - Intronic
1087591098 11:100188822-100188844 TCAACCTATGTGCCCATCAATGG + Intronic
1087980286 11:104604951-104604973 TCCAATGATCTGCCCACCTTGGG - Intergenic
1088554147 11:111044626-111044648 TCAACTTAAGTGCCCATCAATGG - Intergenic
1090552047 11:127830558-127830580 TCTACTAATGAGCCCACCAAAGG - Intergenic
1090895201 11:130965634-130965656 TCAACTTAGGTGCCCATCAGTGG - Intergenic
1092636544 12:10456791-10456813 TCAACTTATGTGCTCATCAGTGG - Intergenic
1092941751 12:13415710-13415732 TCAACTTAAGTGCCCATCAATGG + Intergenic
1093592832 12:20926225-20926247 TCAACTTAAGTGCCCATCAGTGG - Intergenic
1094334615 12:29334754-29334776 TACACTTATGTGATCACCAAAGG + Exonic
1095816571 12:46429161-46429183 TCAACCTAGGTGCCCACCAGCGG + Intergenic
1095954822 12:47799914-47799936 TCCACTTGTGTGCCCTCCCATGG - Intronic
1096010328 12:48208449-48208471 TCAACCTATGTGCCCATCAACGG + Intergenic
1096064175 12:48725998-48726020 TCTACTGATGAGCCCACCAAAGG - Intergenic
1100729673 12:97450682-97450704 TCAACCTATGTGCCCATCAGTGG - Intergenic
1100942270 12:99737279-99737301 TCAACTTAAGTGCCCATCAACGG + Intronic
1102252312 12:111395804-111395826 ACAACTCATGTGCCCACCAGGGG - Intergenic
1102711023 12:114927014-114927036 TCTACTTATGTAACCACCCTAGG - Intergenic
1102974742 12:117198493-117198515 TCCACTTCTCTGCCCACCTGAGG + Intergenic
1107089795 13:36465954-36465976 TCAACTTATGTGTCCATCAGTGG - Intergenic
1109311776 13:60703331-60703353 TCAACCTAGGTGCCCACCATGGG - Intergenic
1109739458 13:66533042-66533064 GCCACTTATGTGCCCACACTGGG + Intronic
1110808526 13:79787027-79787049 TCAACTTAAGTGCCCATCAATGG - Intergenic
1111994051 13:95145692-95145714 TCAACTTAGGTGCCCATCAATGG + Intronic
1112076715 13:95922019-95922041 TCAACCTAGGTGCCCACCAATGG + Intronic
1112138102 13:96606314-96606336 TCAACTTATATGCCCATCAGTGG + Intronic
1112264476 13:97910688-97910710 TCAACCTAGGTGCCCACCAATGG + Intergenic
1113358613 13:109607430-109607452 TCCACTTAAATACCCACCAGCGG - Intergenic
1114754541 14:25244926-25244948 GCCAGATATGTGCCCACCTTTGG - Intergenic
1116604425 14:46971307-46971329 TCAACCTATGTGTCCACCAATGG + Intronic
1120303483 14:82737767-82737789 TCAACCTATGTGCCCATCAATGG - Intergenic
1121089254 14:91169986-91170008 TCCCCTTATGTCCCCAGGATGGG + Exonic
1123501252 15:20883448-20883470 TCCAAGTATGTGCGCTCCATAGG + Intergenic
1123594735 15:21894428-21894450 TCCAAGTATGTGCGCTCCATAGG + Intergenic
1124184987 15:27517155-27517177 TCCACGCATGTGCCCAACACTGG + Intronic
1124397899 15:29320742-29320764 TCTACTTATGAGCCCATCAAAGG - Intronic
1202966854 15_KI270727v1_random:184303-184325 TCCAAGTATGTGCGCTCCATAGG + Intergenic
1133460410 16:5982234-5982256 TCCAGGGATGTTCCCACCATAGG + Intergenic
1133672605 16:8038625-8038647 TCCATATATGTGCCACCCATGGG - Intergenic
1138147784 16:54627758-54627780 TCCTGTTCTGAGCCCACCATGGG - Intergenic
1139913301 16:70412039-70412061 TCCACTTCTGTGCTCACTGTTGG + Intronic
1140252570 16:73306958-73306980 CCCACTTACCAGCCCACCATTGG - Intergenic
1143831551 17:9656027-9656049 TCCACTAATCTTCCCTCCATTGG - Intronic
1145311038 17:21701191-21701213 GCCACTGATGTGCCCACCCCCGG - Intronic
1147553621 17:41462581-41462603 TCCTTCTAAGTGCCCACCATGGG - Intronic
1147740293 17:42667549-42667571 TCCACCTCTGGGCCCATCATTGG - Intergenic
1149059999 17:52410576-52410598 TCTGCTTATGTGCCCAGCGTTGG + Intergenic
1149101776 17:52915398-52915420 TCAACTTACGTGTCCATCATGGG - Intergenic
1153065142 18:1036819-1036841 CCAACTTATGTGCCCATCAACGG - Intergenic
1154503555 18:15009696-15009718 TCAACCTAGGTGCCCATCATTGG + Intergenic
1155773597 18:29730481-29730503 TCAACTTAAGTGTCCACCAATGG + Intergenic
1157448244 18:47764549-47764571 TCCACATAAGTGCCCATCAATGG + Intergenic
1158037518 18:53051333-53051355 TCCTCTCATTTGCCCACCTTTGG + Intronic
1158862225 18:61603756-61603778 CCCACTTCAGTGTCCACCATTGG - Intergenic
1159235566 18:65668375-65668397 TCAACCTATGTGCCCATCAACGG - Intergenic
1160375711 18:78410167-78410189 TCCTCTCCTCTGCCCACCATGGG + Intergenic
1161794092 19:6376428-6376450 TCCCCTTGTGTCCCCACCCTTGG - Intronic
1162171093 19:8789611-8789633 TCCATTTATACCCCCACCATAGG - Intergenic
1162779740 19:13000804-13000826 TCCAGCCAAGTGCCCACCATAGG - Intronic
1163248534 19:16112004-16112026 TCCACTTTTATCTCCACCATAGG + Exonic
1164407365 19:27963115-27963137 TGGACTTATGTGCACTCCATAGG - Intergenic
1164880586 19:31729424-31729446 TCAACCTAAGTGCCCACCAATGG + Intergenic
1165366429 19:35370135-35370157 TCAACTTAGGTGCCCATCAATGG + Intergenic
1167984119 19:53300692-53300714 TTCACTTCTGTGCCCTTCATGGG - Intergenic
1168053806 19:53849623-53849645 TCCACCTAGGTGTCCACCAATGG + Intergenic
925702532 2:6652971-6652993 TCGACTTATATGCCCAGCGTGGG - Intergenic
926694608 2:15762597-15762619 TCCACTGGTGTGCCCAGCCTTGG + Intergenic
927237923 2:20894073-20894095 TCAACTTAGGTGCCCATCAGTGG + Intergenic
927705523 2:25294227-25294249 TGCACTTAAGTCCCCACCATGGG + Intronic
927874593 2:26647081-26647103 TCCACCTTTGTCCCCAGCATGGG - Intergenic
927983538 2:27391082-27391104 TCAACTCATGTGCCCATCAGTGG - Intronic
928115757 2:28544306-28544328 TCCTCTTCTCTGCCCATCATGGG - Intronic
929382820 2:41372613-41372635 TCAACTTAAGTGCCCATCAGTGG + Intergenic
929506753 2:42534254-42534276 TACACTTCAGTGCCCACCCTAGG + Intronic
931073532 2:58683255-58683277 TCAACTTATATGCCCATCAATGG - Intergenic
931543111 2:63351668-63351690 TCCACTCATGTGCCTATCAATGG - Intronic
932488274 2:72100296-72100318 TCCTCTTATGTAACCACCAATGG - Intergenic
933323619 2:80808612-80808634 TCAACTTAGGTGCCCATCAGTGG + Intergenic
935750257 2:106226395-106226417 TCAACTTAGGTGCCCATCAATGG + Intergenic
935964120 2:108455814-108455836 TCAACTTAAGTGCCCATCAAAGG - Intronic
936120950 2:109744022-109744044 TCAACTTAGGTGCCCATCAATGG - Intergenic
936223745 2:110627454-110627476 TCAACTTAGGTGCCCATCAATGG + Intergenic
936803928 2:116302200-116302222 TCAACTTAAGTGCCCATCAATGG + Intergenic
936859520 2:117000731-117000753 TCAACCTATGTGTCCACCAATGG + Intergenic
936988474 2:118335618-118335640 TCAACTTATGTGTCCATCAATGG - Intergenic
937313925 2:120919284-120919306 TCCAATTTTGTTCCCACTATGGG - Intronic
938390824 2:130903923-130903945 TCAACTTAGGTGCCCATCAGTGG - Intronic
938502730 2:131839827-131839849 TCAACTTATGTGCCCATCATTGG + Intergenic
939084533 2:137702084-137702106 TACACTTTTGTAACCACCATGGG - Intergenic
939414177 2:141871609-141871631 ACCACTTATGTGCCAAACACAGG - Intronic
941146108 2:161847772-161847794 TCAACCTATGTGCCTACCAGTGG - Intronic
941820419 2:169839112-169839134 TCAACTTAAATGCCCACCAATGG + Intronic
942039263 2:172041477-172041499 TCCACTTAAATGCTCATCATTGG + Intronic
942613227 2:177763302-177763324 TCCTCTTCTGTGCCCGCCTTTGG - Intronic
945271187 2:207942149-207942171 TCAACTTAAGTGCCCATCAATGG + Intronic
945658463 2:212654619-212654641 TCGACTTATATGCCCACTAATGG - Intergenic
1173715696 20:45202831-45202853 TCGACTTAGGTGCCCATCAATGG + Intergenic
1174686381 20:52459764-52459786 TCCACCTAGGTGCCCATCAGTGG + Intergenic
1175048610 20:56131465-56131487 TCAACCTAGGTGCCCATCATTGG + Intergenic
1175395880 20:58661235-58661257 ACCACTTATGTGCCCCTCCTTGG - Intronic
1176062898 20:63179973-63179995 GCCACTTCTGTGCCCTCCAGGGG - Intergenic
1177769020 21:25493838-25493860 TCAAATTAGGTGCCCACCAACGG + Intergenic
1178311078 21:31530618-31530640 TCCAGGTGTGTGCCCACCAGGGG - Intronic
1179031422 21:37723514-37723536 TCAACCTAGGTGCCCATCATTGG + Intronic
1179172556 21:38983810-38983832 TCAACCTAAGTGCCCACCAATGG - Intergenic
1181896835 22:26117178-26117200 TTCACCTAAGTGCCCACCAGTGG + Intergenic
1182852906 22:33491705-33491727 CCCATTTTTGTGCCCACCATTGG + Intronic
1183047862 22:35234776-35234798 TCAACTTAGGTGCCCATCAATGG - Intergenic
949150039 3:755703-755725 TCAACTTAGGTGCCCATCAATGG - Intergenic
949668090 3:6364874-6364896 TCAACTTAGGTGCCCATCAATGG + Intergenic
950627835 3:14261128-14261150 ACAACTTATGTGTCCACCATGGG - Intergenic
953783789 3:45895311-45895333 ACAACTAATGTGCCCACCATGGG - Intronic
955550753 3:60082372-60082394 TCAACTTAGGTGCCCATCAATGG - Intronic
956283319 3:67582514-67582536 TCAACTTAGGTGCCCATCACTGG - Intronic
957351807 3:79033235-79033257 TCCACAAATGTGCCAACAATTGG - Intronic
958770526 3:98421066-98421088 TCAACCTATGTGCCCATCAATGG + Intergenic
958936292 3:100259882-100259904 GCCACCTATGTGGCCACCTTGGG + Intergenic
959970646 3:112405858-112405880 CCCACTTTTGTGCACTCCATAGG - Intergenic
961181216 3:124879241-124879263 TCCACTTCTGTACACCCCATGGG + Intronic
961334631 3:126164617-126164639 TCAACTTAGGTGCCCAACAATGG - Intronic
961345972 3:126263635-126263657 ACCACTTCTGTGCCCAGCACTGG - Intergenic
962211585 3:133483685-133483707 TCAACTTAAGTGCCCATCAGTGG - Intergenic
963384640 3:144575641-144575663 TCAACTTAGGTGCCCATCAATGG + Intergenic
964450097 3:156803935-156803957 TCCACTTTTGTTTCCATCATAGG - Intergenic
967239489 3:187423493-187423515 TCAACTTATGTGTCCATCAATGG + Intergenic
967430741 3:189382550-189382572 TCCACTAATGAGCCCAGCAATGG + Intergenic
967548267 3:190758511-190758533 TCTACTAATGGGCCCACCAAAGG + Intergenic
967834162 3:193946767-193946789 TCAACCTAGGTGCCCACCACTGG - Intergenic
970563350 4:17305354-17305376 TCCACCTAAGTGTCCACCAATGG - Intergenic
970876364 4:20875169-20875191 TCCACTTACCTGCTCAACATGGG - Intronic
971800384 4:31282553-31282575 TCAACTTACGTGTCCACCAATGG + Intergenic
972167919 4:36310098-36310120 TCAACTTACGTGCCCATCAATGG - Intronic
972834129 4:42848152-42848174 TCAACCTAGGTGCCCACCAATGG - Intergenic
973027192 4:45287375-45287397 TCAACATAGGTGCCCATCATTGG - Intergenic
973832992 4:54780632-54780654 CCCACTAATGTGGCCACCAAAGG - Intergenic
973984904 4:56341252-56341274 TGCACTTAAGTGTCCACCAATGG + Intronic
980555455 4:134397508-134397530 TCAACTTAAATGCCCACCAATGG - Intergenic
981656832 4:147121130-147121152 TCAACTTAAGTGTCCACCAATGG + Intergenic
982978667 4:162102457-162102479 TCCAATTATGTGCCAGCCTTTGG + Intronic
983876873 4:172887231-172887253 TCAACCTATGTGCCCATCAATGG - Intronic
985970092 5:3369096-3369118 TCAACCTATGTGCCCATCAGTGG - Intergenic
987048180 5:14126934-14126956 ACCAATGCTGTGCCCACCATGGG - Intergenic
987544212 5:19291283-19291305 TCCACTTCTGTGTGCATCATAGG - Intergenic
989089425 5:37714597-37714619 TCCCATTCTGTGCCCACCAGTGG + Intronic
990502764 5:56413091-56413113 TCCACTCATTTCCCCACCACCGG - Intergenic
990511004 5:56488925-56488947 TCCCCTAATGTGCCCAGAATTGG - Intergenic
993219258 5:85069750-85069772 TACACTGTTGTGCCCACCTTTGG + Intergenic
995986951 5:118188319-118188341 TCAACTTAAGTGTCCACCAATGG + Intergenic
998007752 5:138668349-138668371 TCCAAATATGAGCCCACCACAGG - Intronic
998397883 5:141831083-141831105 TCAAGTTACGTGCCCACCCTGGG + Intergenic
1000275478 5:159730984-159731006 TCAACTTAGGTGCCCATCAATGG + Intergenic
1001276216 5:170353625-170353647 TCCACTTAAGTCCTCACCACGGG - Intronic
1001715992 5:173816646-173816668 TCCGCTTATGTCCCCACCTCTGG - Intergenic
1002412040 5:179088284-179088306 TCTACTGATGAGCCCACCAAAGG + Intergenic
1003415211 6:5901171-5901193 TCAACTTAAGTGCCCATCAATGG + Intergenic
1005471021 6:26162771-26162793 TCAAGTGATCTGCCCACCATGGG + Intronic
1007815133 6:44517028-44517050 TCAACCTAAGTGCCCACCAATGG - Intergenic
1008289726 6:49699840-49699862 TGCACTTGTTTGCCCACCTTTGG + Exonic
1010160787 6:72852352-72852374 TCAACCTATGTGCCCATCAATGG + Intronic
1010291601 6:74143846-74143868 TCAACTTAAGTGCCCATCAATGG - Intergenic
1010457137 6:76069717-76069739 TCAACCTAGGTGCCCATCATTGG + Intronic
1012065992 6:94553117-94553139 TCCACTGATTTACCCACCAGTGG + Intergenic
1013879868 6:114884265-114884287 TCCACTTAGGTGCCCATCAGTGG + Intergenic
1014786326 6:125623921-125623943 CCCAGTTAGGTGCTCACCATTGG - Intergenic
1016933836 6:149434392-149434414 TCCACCTAGGTGCCCATCAGTGG + Intergenic
1017368607 6:153676304-153676326 TCCACCTAGGTGCCCATCAGTGG - Intergenic
1017685718 6:156912429-156912451 TCCACTTTTGTGCCCACTCCAGG + Intronic
1020491386 7:8788530-8788552 TCAACCTAAGTGCCCACCAATGG - Intergenic
1021213092 7:17880596-17880618 TCCACTTCTGTTTCCACCCTTGG - Intronic
1021488573 7:21193675-21193697 GCCACTTATGGTTCCACCATGGG - Intergenic
1023144351 7:37134654-37134676 TCCACCTATGTGTCCACCAATGG + Intronic
1023631220 7:42166291-42166313 ATCTCTTATGTGCACACCATAGG + Intronic
1023888202 7:44375552-44375574 TGCACTACTGTGCCCACCACTGG + Intergenic
1025029275 7:55543290-55543312 TCCACCTAAGTGCCCATCAGTGG - Intronic
1025059516 7:55792740-55792762 TCAACTTATATGCCCATCAGTGG - Intergenic
1025215844 7:57055505-57055527 TCCACCTAAGTGCCCATCAAGGG + Intergenic
1025655535 7:63515197-63515219 TCCACCTAAGTGCCCATCAAGGG - Intergenic
1026190354 7:68120153-68120175 TCCACCTAAGTGCCCATCAATGG + Intergenic
1026412155 7:70134589-70134611 TCCACATATGTGCCTTGCATTGG + Intronic
1026486662 7:70827872-70827894 TCAACTTAAGTGCCCATCAATGG - Intergenic
1027331522 7:77100388-77100410 TCAACCTATGTGCCCATCAGTGG - Intergenic
1028348282 7:89811323-89811345 TCAACTTAAGTGCCCATCAGTGG + Intergenic
1029784249 7:102770952-102770974 TCAACCTATGTGCCCATCAGTGG + Intronic
1030489689 7:110216130-110216152 TCCACATATGTGACAATCATTGG - Intergenic
1033921254 7:146395142-146395164 TCCACCTATGTGTCCATCAGTGG - Intronic
1035846876 8:2874925-2874947 TCCACTAATGTCACCACCAGGGG + Intergenic
1036436746 8:8741970-8741992 TCAACTTAGGTGCCCATCAATGG - Intergenic
1036481414 8:9142906-9142928 TCAACCTAAGTGCCCATCATTGG - Intronic
1036484618 8:9168157-9168179 TGCAGTGATGTGCTCACCATTGG + Intergenic
1038317477 8:26499979-26500001 TCAACCTAAGTGCCCATCATTGG + Intronic
1038394080 8:27233882-27233904 TCTAATTATGTGCCCAGCATGGG - Intergenic
1038872125 8:31506110-31506132 TCAACCTAGGTGCCCACCAACGG - Intergenic
1039438229 8:37576162-37576184 TCCACTTATATGTCCATCAGTGG - Intergenic
1039530034 8:38252749-38252771 TCCACTCCTGGGACCACCATTGG - Exonic
1039860324 8:41451994-41452016 TCTACTAATGTGCCCACCAAAGG + Intergenic
1041096958 8:54360039-54360061 TCAACCTATGTGCCCATCAGTGG + Intergenic
1041827094 8:62108369-62108391 TCAACTTAGGTGCCCATCAATGG + Intergenic
1041854005 8:62428240-62428262 TCAACTTATGTGCCCTTCAATGG - Intronic
1044121126 8:88397452-88397474 TCTACTTGTGTTGCCACCATAGG + Intergenic
1044201327 8:89441839-89441861 TCAACCTATGTGCCCATCAATGG + Intergenic
1044320800 8:90798696-90798718 TCAACTTAAGTGCCCATCAGTGG - Intronic
1044881288 8:96725828-96725850 TCAACCTAGGTGCCCATCATTGG + Intronic
1046784159 8:118248255-118248277 TCCACTTCTGTTCCCAATATAGG + Intronic
1047068239 8:121311703-121311725 TAAACATATGTGCCCAACATTGG - Intergenic
1048113083 8:131488869-131488891 TCCAGTGATCTGCCCACCTTGGG - Intergenic
1049066454 8:140320274-140320296 TCCACTTATGTAGACACCAGGGG - Intronic
1050882677 9:10722478-10722500 TCCACTTTTGTACCCACAAAGGG - Intergenic
1051040883 9:12809405-12809427 TCTACTTATGAGCCCATCAAAGG + Intronic
1053428667 9:38027613-38027635 TCCATCTAGTTGCCCACCATGGG - Intronic
1055015909 9:71617946-71617968 TCAACTTAAGTGCCCATCAAAGG + Intergenic
1055412453 9:76045765-76045787 ATCACTTCAGTGCCCACCATAGG - Intronic
1055675745 9:78658402-78658424 TCAACCTAGGTGCCCACCAATGG - Intergenic
1056566870 9:87780810-87780832 TAATCTTATGTGACCACCATTGG + Intergenic
1056621428 9:88217871-88217893 TCCACTGCTGTGCTCCCCATTGG - Intergenic
1058221071 9:102303316-102303338 TCAACTTAGGTGCCCATCAATGG - Intergenic
1058986968 9:110217575-110217597 TTCACTTCTGTCCCCACCACTGG - Intergenic
1059737735 9:117119061-117119083 TTCACTTAAGTGCCCAGCATTGG + Intronic
1062216209 9:135391064-135391086 TCCAGCTTTGTGGCCACCATCGG + Intergenic
1186698161 X:12059856-12059878 TCAACTTAAGTGCCCATCAATGG - Intergenic
1186995402 X:15116178-15116200 TCAACTTAGGTGCCCATCAGTGG + Intergenic
1187643907 X:21325766-21325788 TCTACTGATGTGTCCACCAAAGG + Intergenic
1188135305 X:26487424-26487446 TCAACTTAAGTGCCCATCAGTGG + Intergenic
1188179947 X:27042852-27042874 TCTACTTATGAGCCCATCAAAGG - Intergenic
1188180007 X:27043778-27043800 TCTACTGATGAGCCCACCAAAGG + Intergenic
1188229931 X:27649206-27649228 TCAACTTAGGTGCCCAACACTGG - Intronic
1188371220 X:29371838-29371860 TCAACTTAGGTGCCCATCAATGG - Intronic
1188599329 X:31941929-31941951 TCAACCTAGGTGCCCACCAGTGG - Intronic
1188936189 X:36177925-36177947 TCAACTTAGGTGCCCATCAATGG + Intergenic
1190096605 X:47486174-47486196 TCAAGTTATTTGCCCACCTTGGG - Intergenic
1194012521 X:88580589-88580611 TCAACTTAGGTGCCCATCAATGG + Intergenic
1194233454 X:91352434-91352456 TCAACTTAGGTGCCCATCAACGG + Intergenic
1200942008 Y:8793829-8793851 TCAACCTAGGTGCCCACCAATGG + Intergenic
1201607585 Y:15804075-15804097 TCAACCTATGTGCCCATCAATGG + Intergenic