ID: 1086614223

View in Genome Browser
Species Human (GRCh38)
Location 11:88795442-88795464
Sequence ACAAAGATACTCTACTAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 179
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 170}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086614223 Original CRISPR ACAAAGATACTCTACTAGGA TGG Intronic
904338171 1:29811255-29811277 TCAGCGATACTCTACTAGGTTGG - Intergenic
907580275 1:55566310-55566332 ACAAAGATACTCCTCGAGAAGGG - Intergenic
907942927 1:59106575-59106597 CCAAAGACACTCTGCTAGAAGGG + Intergenic
909677558 1:78254852-78254874 ACAAAAAAACACTACTATGATGG - Intergenic
913342058 1:117768449-117768471 ACAAAGATACTCCTCGAGAAGGG - Intergenic
913467248 1:119155760-119155782 ACAAAGATACTCCTCGAGAAGGG - Intergenic
913512631 1:119575525-119575547 ACAAAGATACTCCTCGAGAAGGG + Intergenic
914375068 1:147065562-147065584 ACAAAGATACTCCTCGAGAAGGG + Intergenic
918893005 1:190300037-190300059 ACAAAGATACTCCTCGAGAAGGG - Intronic
923416589 1:233768643-233768665 ACAAAGATACTCCTCGAGAAGGG - Intergenic
1064769927 10:18712577-18712599 AAACAGATACTCTACTAGGAAGG - Intergenic
1064949609 10:20833774-20833796 AAAAAGAATGTCTACTAGGAAGG + Intronic
1066695847 10:38076920-38076942 ACAGAGACCCTCTACTAGGGTGG - Intergenic
1066996689 10:42570638-42570660 ACAGAGAACCTCTACTAGGGTGG + Intergenic
1069353565 10:67558243-67558265 CCAAATATACTCCACTAGAAAGG + Intronic
1070338887 10:75478787-75478809 ACAGAGATACTCTTTTAGGCAGG - Intronic
1070473999 10:76814326-76814348 ACAAAGATACTCCTCGAGAAGGG - Intergenic
1070477909 10:76847863-76847885 ACAAAGATACTCCTCGAGAAGGG + Intergenic
1072815625 10:98506152-98506174 ATAAAGATTCCCTACTTGGAAGG - Intronic
1075201462 10:120408216-120408238 ACAAAGATCCACAACTGGGATGG + Intergenic
1075576186 10:123579335-123579357 ACAAAGGTTCTCCACTTGGAAGG + Intergenic
1080945564 11:36969806-36969828 ACAAAAATAATTTTCTAGGAAGG - Intergenic
1086614223 11:88795442-88795464 ACAAAGATACTCTACTAGGATGG + Intronic
1087615247 11:100480205-100480227 ACAAAGATACTCCTCGAGAAGGG - Intergenic
1089179480 11:116571771-116571793 ACAAAGATACTCCTCGAGAAGGG + Intergenic
1089499379 11:118923545-118923567 AGAATGAGTCTCTACTAGGATGG - Intronic
1089951959 11:122536227-122536249 ACAGAGAACCTCTACTAGGGAGG + Intergenic
1090027921 11:123183550-123183572 AGCAAGATACTCTACTACTAGGG + Intronic
1094171744 12:27500735-27500757 CTTAAGATACTCTATTAGGAAGG - Intronic
1094259352 12:28475514-28475536 CCAAAGTTAATTTACTAGGAAGG - Intronic
1094791362 12:33919388-33919410 ACAAAGATACTCCTCGAGAAGGG - Intergenic
1095483260 12:42657854-42657876 ACAAAGATACTCCTCGAGAAGGG - Intergenic
1098561913 12:71883653-71883675 ACAAAGATAAACTACTTAGAAGG - Intronic
1101601075 12:106210960-106210982 ACAAAGATACTCCTCAAGAAGGG - Intergenic
1101691506 12:107086801-107086823 ACAGAGAGATTCTACTAGGCTGG + Intronic
1106445610 13:29828166-29828188 ACAAAGATACTCCTCGAGAAGGG - Intronic
1106737835 13:32606554-32606576 ACAAAGATACTCCTCGAGAAGGG - Intronic
1109127955 13:58542210-58542232 ATAAAGATACTCGCCTAGTATGG - Intergenic
1109363399 13:61325230-61325252 ACAAAGATACTCCTCGAGAAGGG + Intergenic
1110209192 13:72952734-72952756 ACAAAGATTCTCTACAACTAAGG - Intronic
1112512733 13:100024231-100024253 ACAAAGTTACTCAACCAGGCTGG - Intergenic
1113243602 13:108368504-108368526 ACAAAGATACTCTAGCAAGCTGG + Intergenic
1113264716 13:108605270-108605292 ACAAAGATAGATTACTAAGATGG - Intronic
1114939714 14:27593141-27593163 ACAAAGTTACGCCACTGGGAAGG - Intergenic
1115521700 14:34239462-34239484 ACAAAGGGACTCTAGAAGGATGG - Intronic
1115799816 14:36980233-36980255 ACAAAGATACTCCTCGAGAAGGG - Intronic
1115889664 14:38012519-38012541 AAAAAGAATCTCTACTAGGATGG + Intronic
1116749419 14:48864447-48864469 ACAAAGATACTCTATCAAAATGG + Intergenic
1117452299 14:55863269-55863291 ACAAAGATACTCCTCGAGAAGGG + Intergenic
1120514201 14:85451181-85451203 AAAAAGAAACACTACTAGAATGG + Intergenic
1120612659 14:86661485-86661507 AAAAACCTACTCTAGTAGGATGG + Intergenic
1123427092 15:20181646-20181668 ATAAAGATATTCTAAGAGGAAGG - Intergenic
1123536321 15:21188155-21188177 ATAAAGATATTCTAAGAGGAAGG - Intergenic
1124930111 15:34111592-34111614 ACACAGAGACTATACAAGGAGGG - Intergenic
1128086623 15:64891243-64891265 GCAAAGTTACTCTGCTGGGATGG - Intronic
1134462318 16:14440079-14440101 ACAAATATATTCTTCTAGGTTGG - Intronic
1135209703 16:20514233-20514255 ACAAATATACTCTACCACAAAGG + Intergenic
1136857206 16:33668190-33668212 ATAAAGATATTCTAAGAGGAAGG + Intergenic
1138153861 16:54684987-54685009 ACAAAGAGACTGTGATAGGAAGG + Intergenic
1140211462 16:72973874-72973896 AAAAAAAAACTCTACTCGGAAGG + Intronic
1140821483 16:78667235-78667257 AGAAAGATAGTCTGCTACGAGGG - Intronic
1142353230 16:89589295-89589317 AAAAAGAGACTCTGCGAGGAAGG + Intronic
1203118779 16_KI270728v1_random:1516681-1516703 ATAAAGATATTCTAAGAGGAAGG + Intergenic
1146337463 17:31987005-31987027 ACTGAGATACTCTAGTAGTAAGG + Intronic
1146610009 17:34296936-34296958 ACAAAGATACTCCTCGAGCAGGG - Intergenic
1150514886 17:65797892-65797914 ACAATGATACTCTACATGAAGGG - Intronic
1155622906 18:27801254-27801276 GCAATGATACTCTAGTAAGAAGG - Intergenic
1158824451 18:61200481-61200503 TCAAAAATATTCTACTTGGAAGG + Intergenic
1158904759 18:62001230-62001252 CCAGAGAAACTCTACTAGGGTGG - Intergenic
1159328766 18:66959988-66960010 ACAAACACACTCTACTTGAAGGG + Intergenic
1159473605 18:68889009-68889031 ACAAAGAAAAACTACTGGGAGGG - Intronic
1165011177 19:32847690-32847712 ACAAAGATACTCCTCGAGAAGGG + Intronic
1168141284 19:54389101-54389123 CCAAAGATCCTCCGCTAGGAAGG + Intergenic
925524522 2:4785337-4785359 TCAAAGATGCTATACTAGGTAGG + Intergenic
927394952 2:22639018-22639040 ACAAAGATTCTCTAAAATGAAGG + Intergenic
928396721 2:30948348-30948370 ACAAAGACAGTCTTCTAGGCAGG - Intronic
930646242 2:53911632-53911654 AGACACATACTCTAATAGGATGG - Intronic
931658360 2:64531183-64531205 ACCAAGATGCTCTTCTATGATGG - Intronic
931757753 2:65388999-65389021 ACAGAGATTCTGTACTGGGAGGG + Intronic
933188395 2:79304352-79304374 ACTAAGATACTGTTCTGGGATGG - Intronic
933269137 2:80214745-80214767 ACAAAGATACTCCTCAAGAAGGG - Intronic
933413027 2:81949692-81949714 ACAAAGATAGTCCTCTAGAAAGG - Intergenic
935003439 2:99045238-99045260 ACAAAGATACTCCTCGAGAAGGG + Intronic
940030379 2:149256126-149256148 ACAAAGATACTCCTCGAGAAGGG - Intergenic
940995986 2:160150111-160150133 ACAAAGATACTCCTCGAGAAGGG + Intronic
943115700 2:183667334-183667356 AAAGAGATACTCTACCAGAAGGG + Intergenic
943352651 2:186813516-186813538 ACAAAGATACTCCGCGAGAAGGG + Intergenic
943451834 2:188052158-188052180 ACAGAGATCATTTACTAGGAAGG - Intergenic
944445257 2:199782495-199782517 ACATAGCTTCTCTACTGGGAAGG + Intronic
945392758 2:209284568-209284590 ACAAAGATACTCCTCGAGAAGGG - Intergenic
947137456 2:226989195-226989217 ACAAAGAAATTCTACTTGGAGGG + Intronic
1169752638 20:9010298-9010320 ACAAATTTATTCAACTAGGAAGG + Intergenic
1170822279 20:19764872-19764894 ACATACAAATTCTACTAGGAAGG + Intergenic
1173639906 20:44594299-44594321 ACAATGATACTTTACTTGTAAGG - Intronic
1182870476 22:33642036-33642058 ACAAAGATAGTCTTCCAGAAAGG + Intronic
949258104 3:2074176-2074198 ACACAGATAATCTATTAGGCTGG + Intergenic
951183003 3:19681163-19681185 ACAAAGATACTCCTCGAGAAGGG - Intergenic
952807963 3:37375160-37375182 ACAGAGAACCTCTACTAGGATGG - Intergenic
952911082 3:38186999-38187021 ACAGAACTAATCTACTAGGATGG - Intronic
955652835 3:61212656-61212678 ACAAAGATACTCCTCGAGAAGGG + Intronic
957344732 3:78946176-78946198 ACAAAGATACTCCTCGAGAAGGG + Intronic
960835907 3:121906846-121906868 ACAAAGATACTCCTCGAGAAGGG - Intronic
963712735 3:148766200-148766222 ACAAAGATACTCCTCGAGAAGGG - Intergenic
966533132 3:181002989-181003011 ACAAAGATACTCCTCAAGAAGGG - Intergenic
971731868 4:30394548-30394570 AAAAAGATATTTTACAAGGAGGG + Intergenic
971794858 4:31214045-31214067 ACAAAGCTACCCAACTTGGAGGG + Intergenic
972307977 4:37850692-37850714 TGAAAGAGACTCTACTAGGCTGG + Intronic
973799390 4:54461428-54461450 ACAAAGATACTCTTCAAGAAGGG + Intergenic
974103456 4:57442025-57442047 AGAAAGATCCTCTACTAAAAGGG - Intergenic
974536640 4:63183380-63183402 ACAAAGATACTCCTCGAGAAGGG + Intergenic
976945332 4:90758816-90758838 ACAAAAATAGTGTAGTAGGATGG + Intronic
977806136 4:101300039-101300061 AGAAACATAGTCTACTAAGAAGG + Intronic
979293459 4:119003651-119003673 ACATAGAGACTATACTGGGAGGG - Intronic
980197087 4:129603260-129603282 ACAAAGATTCTTTGCTAGGCTGG + Intergenic
980264829 4:130501814-130501836 ACAATGATCATCTACTAGCAAGG + Intergenic
980583556 4:134785652-134785674 ACAAAGATACTCCTCAAGAAGGG - Intergenic
981139352 4:141250835-141250857 ACAAAGATACTCCACACGAATGG - Intergenic
981296845 4:143142018-143142040 ACAAAGATACTCCTCGAGAAGGG + Intergenic
981789474 4:148520390-148520412 ACAAAGATACTCCTCAAGAAGGG - Intergenic
984224574 4:177018866-177018888 ACAAAGATACTCCTCGAGAAGGG + Intergenic
988770978 5:34433244-34433266 ACAAAGATACTCCTCGAGAAGGG - Intergenic
989249494 5:39293115-39293137 GCAAAGATAAACAACTAGGAAGG + Intronic
989656161 5:43747699-43747721 ACAAAGATACTCCTCAAGAAGGG - Intergenic
989682191 5:44042570-44042592 ACAAAGATACTCCTCGAGAAGGG + Intergenic
989940766 5:50147095-50147117 ACAAAGATACTCCTCGAGAAGGG + Intergenic
994826432 5:104718731-104718753 ACAAAGATACTCCTCGAGAAGGG + Intergenic
995093754 5:108211814-108211836 ACAAAGATACTCCTCGAGAAGGG - Intronic
996968968 5:129340431-129340453 ACAAAGAAACTCAACAAGAATGG - Intergenic
999029893 5:148279767-148279789 ACAAAGATACTCCTGAAGGAGGG - Intronic
999711196 5:154320068-154320090 ACAAAGAACCTCTACTAAGCTGG + Intronic
999858083 5:155616914-155616936 TCAAAAATACTCTCCCAGGAGGG + Intergenic
1001439184 5:171725724-171725746 ACAAAGAAACTGAACTAGGATGG - Intergenic
1002860202 6:1073399-1073421 ACAAAGATCCTCTTTTAGGCCGG - Intergenic
1003025519 6:2551767-2551789 ACAACGAGACTCCACAAGGAAGG - Intergenic
1003232780 6:4269784-4269806 ACAAATAAACTCTTCTAGAAAGG + Intergenic
1006548112 6:34796291-34796313 ACCAAAATACTCTACTACTAAGG - Intronic
1009998817 6:70926830-70926852 ACAAAGATACTCCTCCAGAAGGG + Intronic
1010671903 6:78695955-78695977 ACAAAGATACTCCTCGAGAAGGG + Intergenic
1011016060 6:82757088-82757110 ACAAAGATACTCCTCGAGAAGGG - Intergenic
1014223370 6:118821608-118821630 ACTAAGATACTCTTCGAGAAGGG - Intronic
1015330495 6:131973194-131973216 AGATAGATTCTTTACTAGGAAGG - Intergenic
1015840594 6:137472720-137472742 AAAAAGACACTTTACTGGGAGGG + Intergenic
1016323551 6:142874614-142874636 ACAATTATACTCTTCTATGAGGG + Intronic
1016488880 6:144573966-144573988 ACAAGGATACTGAACTGGGATGG + Intronic
1019585551 7:1800408-1800430 ACAAAGATACACAAATATGAGGG - Intergenic
1020948812 7:14649149-14649171 ACAAAGATACTCCTCGAGAAGGG + Intronic
1021017133 7:15548820-15548842 ACAAAGATACTCCTCGAGAAGGG + Intronic
1021352849 7:19616751-19616773 ATAAAGAAAATTTACTAGGAAGG - Intergenic
1027843522 7:83343282-83343304 ACAAAGATACTCCTCGAGAAGGG + Intergenic
1028788203 7:94820809-94820831 ACAAAGATACTCCTCGAGAAGGG - Intergenic
1031189882 7:118535301-118535323 ACAAATATACTATACTAATAGGG + Intergenic
1032473673 7:132197956-132197978 ACAAACCTCCTCTACTAGGTGGG + Intronic
1032711673 7:134466016-134466038 AAAAAGATACTCTACTCAAAAGG + Intergenic
1034792237 7:153982030-153982052 ACAAAGATACTCCTCAAGAAGGG - Intronic
1038470633 8:27815326-27815348 ACAAAAATACCAGACTAGGAGGG + Intronic
1039317825 8:36393070-36393092 ACAAAGATACTCCTCGAGAAGGG - Intergenic
1041140779 8:54816964-54816986 AAAAAGATACTCTCCTAAGCTGG - Intergenic
1041597648 8:59675718-59675740 ACAAATATACTCTCCTGTGAAGG + Intergenic
1043757284 8:84019361-84019383 ACAAAGATACTCCTCGAGAAGGG - Intergenic
1044484126 8:92730106-92730128 ACAATGATACTCTAATAGAGAGG + Intergenic
1045529256 8:102969306-102969328 AAAAAGAAACCCTAGTAGGAAGG - Intronic
1046277971 8:111987233-111987255 ACAAAGATACTCCTCGAGAAGGG + Intergenic
1046881047 8:119308421-119308443 ACAAAGATACTCCTCAAGAAGGG + Intergenic
1047940468 8:129823720-129823742 ACAGAGAAACTCTACTAGAGTGG + Intergenic
1051516106 9:17932106-17932128 ACAGAGATCCTCTACTTGGGGGG - Intergenic
1055408250 9:75998521-75998543 AGAAATATACTCTACTCAGATGG + Intronic
1060440833 9:123637654-123637676 TCAAAGATACTCTAGCAGAAAGG + Intronic
1185805315 X:3051534-3051556 GCAAAGATAATATACAAGGAGGG + Intronic
1188016375 X:25112012-25112034 ACAAAGAACTTCTACTAGGGTGG - Intergenic
1190409719 X:50124529-50124551 ACAAAGATACTGTACAGGGGAGG + Intergenic
1190449691 X:50566115-50566137 TCACAGATGTTCTACTAGGAGGG + Intergenic
1194347549 X:92784975-92784997 ACAGAGATAATCTACTAGGGTGG - Intergenic
1195839266 X:109154820-109154842 ATAAAGATACTCTAATCAGATGG + Intergenic
1196748246 X:119090956-119090978 ACAAAGATACTCTGCAACCAAGG + Intronic
1198851793 X:140972508-140972530 ACAAAGATACAATATTATGAAGG + Intergenic
1199664664 X:150087209-150087231 ACTTAGATACTCTGCTAGCAGGG - Intergenic
1199796359 X:151201474-151201496 ACAAAGATACTCCTCAAGAAGGG + Intergenic
1200655871 Y:5901608-5901630 ACAGAGATAATCTACTAGGGTGG - Intergenic
1201392973 Y:13518784-13518806 ACAAAGATACTCCTCGAGAAGGG - Intergenic