ID: 1086614253

View in Genome Browser
Species Human (GRCh38)
Location 11:88795860-88795882
Sequence CCTATTGTGTAGGAGAGCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 102
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 95}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1086614247_1086614253 20 Left 1086614247 11:88795817-88795839 CCCTTAGCCTGAGAAAACAACGA 0: 1
1: 0
2: 0
3: 8
4: 106
Right 1086614253 11:88795860-88795882 CCTATTGTGTAGGAGAGCCCTGG 0: 1
1: 0
2: 1
3: 5
4: 95
1086614249_1086614253 13 Left 1086614249 11:88795824-88795846 CCTGAGAAAACAACGAGTTTAAT 0: 1
1: 0
2: 1
3: 5
4: 146
Right 1086614253 11:88795860-88795882 CCTATTGTGTAGGAGAGCCCTGG 0: 1
1: 0
2: 1
3: 5
4: 95
1086614248_1086614253 19 Left 1086614248 11:88795818-88795840 CCTTAGCCTGAGAAAACAACGAG 0: 1
1: 0
2: 0
3: 8
4: 118
Right 1086614253 11:88795860-88795882 CCTATTGTGTAGGAGAGCCCTGG 0: 1
1: 0
2: 1
3: 5
4: 95

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086614253 Original CRISPR CCTATTGTGTAGGAGAGCCC TGG Intronic
901887276 1:12231175-12231197 CCCACTGGGTAGGGGAGCCCAGG + Intronic
902677261 1:18017447-18017469 CCTGTTGTGTACCAGACCCCGGG - Intergenic
903665737 1:25006414-25006436 TCTCTTGTGCAGGTGAGCCCAGG + Intergenic
908369102 1:63462636-63462658 CCTATTCTGTAGGTGAGCAAAGG - Intronic
914860379 1:151381250-151381272 GCTAGTGAGTAGCAGAGCCCAGG + Intergenic
916025481 1:160829968-160829990 CATCTTGTGAAGGAGAGCCAAGG - Intergenic
916266734 1:162897598-162897620 TATATTCTGTAGGAGGGCCCAGG + Intergenic
916961510 1:169893916-169893938 TCTATGGTGTAGGAGAAACCCGG - Exonic
923181842 1:231527774-231527796 CATTTTGTTTGGGAGAGCCCTGG + Intergenic
1065614828 10:27509626-27509648 GGGATTGTGTAGGAGAGCACGGG + Intronic
1071665280 10:87549440-87549462 GCTACTGTGTTGGAGAGCACAGG - Intronic
1074986780 10:118666448-118666470 CCTGGTGTGAAGGAGGGCCCTGG - Intergenic
1075932861 10:126314058-126314080 GCTTTTGTCCAGGAGAGCCCTGG - Intronic
1079244224 11:18741268-18741290 CATATTGTCCAGGAGAGGCCAGG + Intronic
1080156386 11:29116495-29116517 CTTACTGTGTAGGAGAGCAGAGG - Intergenic
1080360658 11:31509668-31509690 CCTATTGGTTACGAGAGCCGCGG + Intergenic
1083223995 11:61273311-61273333 CCCATTCTGGAAGAGAGCCCAGG + Exonic
1086614253 11:88795860-88795882 CCTATTGTGTAGGAGAGCCCTGG + Intronic
1088785841 11:113181200-113181222 GCTGTGGTGTGGGAGAGCCCTGG + Intronic
1091457308 12:617619-617641 CCTTCTGTGTAGGAAAGCCCTGG - Intronic
1098983751 12:76987274-76987296 TATATTGTGTTGGAGAGCCAGGG + Intergenic
1099379830 12:81940013-81940035 CATATGTTGTAGGAGAGACCTGG - Intergenic
1102627694 12:114248889-114248911 GCTGTTGTGTAGCAGATCCCTGG - Intergenic
1104605769 12:130186265-130186287 CCTATTGGGTAACACAGCCCCGG - Intergenic
1104735859 12:131135769-131135791 CCTATGGCCTAGGTGAGCCCTGG + Intronic
1105622862 13:22086180-22086202 CCTTCTGTGGAGGAGAGCCTGGG + Intergenic
1106316933 13:28602460-28602482 CACATGGTGTAGGAGAGACCTGG + Intergenic
1110046396 13:70838387-70838409 CGTATCTTGTAGGAGAGACCTGG + Intergenic
1113683273 13:112260196-112260218 AGGATTGTGTGGGAGAGCCCTGG - Intergenic
1123220571 14:106851602-106851624 CTCACTGTGGAGGAGAGCCCTGG + Intergenic
1129709631 15:77813974-77813996 CCTAGGGGGCAGGAGAGCCCAGG - Intronic
1132270387 15:100519223-100519245 CATTTTGTGGAGGAGAACCCTGG + Intronic
1132713385 16:1279022-1279044 CCTATTGTGGAGGAGACCCTGGG + Intergenic
1133271716 16:4613779-4613801 CCTATGGGTTAGGAGAGGCCCGG + Intronic
1133932566 16:10244290-10244312 CCTTTGGTGTAGCAGAGACCCGG - Intergenic
1137423568 16:48357163-48357185 CCTTTTGTGGAGGAGGGACCAGG + Exonic
1137502844 16:49024642-49024664 CCTATTGTGGAGGAGGAGCCAGG - Intergenic
1141861080 16:86716847-86716869 CCTATGTTGTAACAGAGCCCGGG - Intergenic
1142146898 16:88496511-88496533 CCTTTGGTGGAGGAGAGGCCTGG + Intronic
1143072354 17:4307286-4307308 CCTATACTGTAAGAAAGCCCTGG + Intronic
1143135817 17:4711621-4711643 CCTATAGAGTATGAGAACCCGGG + Intronic
1146157940 17:30539686-30539708 CATGTGGAGTAGGAGAGCCCAGG + Intergenic
1146508836 17:33428493-33428515 CCTAGTGTGGATCAGAGCCCAGG + Intronic
1153385992 18:4496669-4496691 ACCATTGTGGAGCAGAGCCCTGG + Intergenic
1155174647 18:23291635-23291657 GCTGTTGTGCAGGAGAGGCCAGG - Intronic
1157487039 18:48095358-48095380 CCTATTTGAGAGGAGAGCCCTGG + Intronic
1160786004 19:900561-900583 CCTAGTGTGTGGGTGAGGCCAGG - Intronic
1160884823 19:1340984-1341006 CCTATTCTGCAGGACAACCCAGG - Intergenic
1162186777 19:8911447-8911469 CCTACTGTGTACCAGACCCCAGG - Intronic
1164101774 19:22061072-22061094 CCTTTTGTGTAGGATTGCCTTGG + Intronic
1167782511 19:51608301-51608323 CCTTTTGGGAAGGAGAGGCCAGG + Intergenic
925609116 2:5689918-5689940 CCTGTCATGTAGGAGAGGCCAGG - Intergenic
927933267 2:27059352-27059374 CCTTTTGGGTACTAGAGCCCAGG - Exonic
933794520 2:85908800-85908822 CCTGTTGCTTAGGAGAGGCCTGG + Intergenic
934174741 2:89568921-89568943 CCTATGCTCCAGGAGAGCCCTGG - Intergenic
934285058 2:91643273-91643295 CCTATGCTCCAGGAGAGCCCTGG - Intergenic
942147521 2:173041312-173041334 TCTTTTGTGTTGGAGAGCTCTGG - Intronic
943540893 2:189212660-189212682 CCTGTGCTGGAGGAGAGCCCTGG - Intergenic
946398082 2:219453441-219453463 GCTGTTGTGTAGAAGAGCTCAGG + Intronic
1181471122 22:23140672-23140694 ACTATTGTGTGGGAGGGCTCTGG - Intronic
1182037150 22:27207944-27207966 CCTGTTGTGCAGGAGAGCCCGGG - Intergenic
952580671 3:34830011-34830033 CCCAATATGTAGTAGAGCCCTGG - Intergenic
953360654 3:42293313-42293335 CATATGTTGTAGGAGAGACCTGG + Intergenic
954428020 3:50453853-50453875 GCTAATGTGGAGGGGAGCCCCGG + Intronic
955657111 3:61256157-61256179 CCTATAGTGAAGGAGAGACAGGG + Intergenic
956422692 3:69101183-69101205 CCTACTGTGTACTAGAGCCCAGG + Intronic
963168588 3:142229113-142229135 ACTGTTGAGTAGGAGAGGCCTGG + Intergenic
964422196 3:156515199-156515221 CCTATTTTGTGGTAGAGCTCTGG - Exonic
966047948 3:175575866-175575888 CCTAATGGGTGGTAGAGCCCAGG - Intronic
970808120 4:20059920-20059942 CCCATTGTGTGGGAGGGACCTGG - Intergenic
971715756 4:30174776-30174798 CCTATAGGGTAGGAGATTCCAGG - Intergenic
973643547 4:52927040-52927062 CCTCTTGAGTAGGACAGTCCCGG + Intronic
974898300 4:67966489-67966511 CCTTTTGTGTCAGAGAGACCTGG - Intergenic
978112625 4:104980528-104980550 CATTTTGTGTAGGACAGGCCTGG - Intergenic
978192974 4:105937214-105937236 CATCTTGTTTAGGAGAACCCCGG - Intronic
981522127 4:145673882-145673904 TCTATTCTGTAGAAGAACCCAGG - Intergenic
984458382 4:180000542-180000564 CATATTGTGGAGCAGTGCCCTGG - Intergenic
988516802 5:31912064-31912086 TCTTTTGTGTAGTAGAGCCAAGG - Intronic
990378013 5:55192525-55192547 CCTATAATGTAGCAGAGCCATGG + Intergenic
1001453892 5:171846383-171846405 CCATTTGTGCAGGAGTGCCCGGG - Intergenic
1007310069 6:40938247-40938269 CCCATTGTCCAGGAGGGCCCAGG + Intergenic
1008980237 6:57474785-57474807 GCTAGTGTGTGAGAGAGCCCAGG + Intronic
1017441953 6:154472893-154472915 CCTATTGTATGGGATAGCCTGGG - Intronic
1019679396 7:2337044-2337066 CCTATTGTGGAGGAGGGCGTGGG + Intronic
1030076653 7:105742840-105742862 CCTGTTTTGGAGGAGGGCCCAGG - Intronic
1036781337 8:11649995-11650017 CCTGTGGTGTAGGAGAGACATGG + Intergenic
1037317938 8:17616715-17616737 CATGTTGTGTAGGAGAACTCGGG + Intronic
1038825813 8:31000558-31000580 CCTGTGGTGTAGCAGAGCCCAGG - Intronic
1043424408 8:80134314-80134336 CCTCTTGTAAAGGTGAGCCCAGG - Intronic
1049704707 8:144035895-144035917 CCAATTCCTTAGGAGAGCCCAGG - Intronic
1050316218 9:4403283-4403305 CATTTTGTGTAGGAGAGGTCTGG - Intergenic
1052830420 9:33210874-33210896 CCTCTGGTTTATGAGAGCCCTGG - Intergenic
1053592797 9:39531531-39531553 CATATTTTGTGGGAGAGACCTGG + Intergenic
1053850533 9:42286244-42286266 CATATTTTGTGGGAGAGACCTGG + Intergenic
1054573506 9:66833748-66833770 CATATTTTGTGGGAGAGACCTGG - Intergenic
1056419613 9:86410748-86410770 CCTATAGTGTAGATGAGACCAGG - Intergenic
1056619586 9:88200565-88200587 CCTAGCGTGTAGGTGAGCTCGGG - Intergenic
1060822079 9:126667146-126667168 CCTATGTTGTAGGAAAGGCCTGG - Intronic
1061980654 9:134101642-134101664 CCTACTGTGTACCAGAGCCCGGG - Intergenic
1188559913 X:31455918-31455940 CCAATTTGGTAGTAGAGCCCAGG - Intronic
1189680002 X:43505968-43505990 GCTATTGTGTAAGAGAAGCCTGG + Intergenic
1194995679 X:100589215-100589237 ACTGTGGTGTAGGAAAGCCCAGG - Intronic