ID: 1086616289

View in Genome Browser
Species Human (GRCh38)
Location 11:88824493-88824515
Sequence CAATTTTTCCACAGGACAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 378
Summary {0: 1, 1: 0, 2: 8, 3: 53, 4: 316}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1086616283_1086616289 15 Left 1086616283 11:88824455-88824477 CCAACTTTACTGGCACCAGGGAC 0: 1
1: 6
2: 101
3: 1326
4: 1923
Right 1086616289 11:88824493-88824515 CAATTTTTCCACAGGACAGTGGG 0: 1
1: 0
2: 8
3: 53
4: 316
1086616280_1086616289 18 Left 1086616280 11:88824452-88824474 CCTCCAACTTTACTGGCACCAGG 0: 1
1: 0
2: 1
3: 78
4: 239
Right 1086616289 11:88824493-88824515 CAATTTTTCCACAGGACAGTGGG 0: 1
1: 0
2: 8
3: 53
4: 316
1086616285_1086616289 0 Left 1086616285 11:88824470-88824492 CCAGGGACCAGTTTCATGGAAGA 0: 275
1: 558
2: 1130
3: 1239
4: 1262
Right 1086616289 11:88824493-88824515 CAATTTTTCCACAGGACAGTGGG 0: 1
1: 0
2: 8
3: 53
4: 316
1086616286_1086616289 -7 Left 1086616286 11:88824477-88824499 CCAGTTTCATGGAAGACAATTTT 0: 366
1: 675
2: 884
3: 752
4: 745
Right 1086616289 11:88824493-88824515 CAATTTTTCCACAGGACAGTGGG 0: 1
1: 0
2: 8
3: 53
4: 316

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086616289 Original CRISPR CAATTTTTCCACAGGACAGT GGG Intronic
901097912 1:6697367-6697389 TAATTTTTCCACAGACTAGTGGG + Intronic
904355717 1:29938028-29938050 CAATTGTACCATAAGACAGTTGG - Intergenic
905662638 1:39739104-39739126 CACTTTTTCCTGAGGACAGTGGG - Intronic
905662746 1:39739805-39739827 CACTTTATCCTGAGGACAGTGGG + Intronic
905689916 1:39935466-39935488 CATTTTTTGCACAGGATAGGTGG + Intergenic
906844519 1:49177255-49177277 CTATGTTTCTACAGTACAGTAGG - Intronic
907017557 1:51032118-51032140 CAATTTTTCCGCAGGGCGGGGGG + Intergenic
907462812 1:54615366-54615388 CACTTTTTCCTGAGGACAATGGG + Intronic
907652030 1:56304284-56304306 TAATTATGCCACAGGACAGCAGG - Intergenic
907982482 1:59497759-59497781 CAATTCTTCCCCATGTCAGTTGG + Intronic
908421374 1:63961763-63961785 CTAGTTTTCGACAGCACAGTAGG + Intronic
908688902 1:66754533-66754555 CCATTTTTGAACAGGAAAGTGGG - Intronic
909043303 1:70679479-70679501 CAATTATGCCAGAGGACATTTGG + Intergenic
909235406 1:73147060-73147082 CAATTTTTCCACAGACCAAGGGG - Intergenic
910529970 1:88224841-88224863 CCATTTCACCACTGGACAGTTGG + Intergenic
911673002 1:100628400-100628422 ACATTTTTCCAAATGACAGTGGG - Intergenic
913275509 1:117134233-117134255 AAATTTTTCCAAATGATAGTTGG + Intergenic
913657085 1:120971620-120971642 CAATTTTTCCACAGACAAGGTGG + Intergenic
914008429 1:143754703-143754725 CAATTTTTCCACAGACAAGGTGG + Intergenic
914521648 1:148422874-148422896 CAATTTTTCCACAGACAAGGTGG + Intergenic
916029342 1:160862672-160862694 CAGCATTTCCACAGGACAGAGGG + Exonic
916149184 1:161769504-161769526 CAATTTTTCCACAGGAGGTGGGG + Intronic
916491737 1:165308170-165308192 CAACATATCCACAGGACAGGAGG + Intronic
917701299 1:177584248-177584270 CAATTTTACCATAGGCAAGTGGG - Intergenic
918081847 1:181213909-181213931 CAATTTTTTCCCATGTCAGTGGG + Intergenic
918613883 1:186522772-186522794 CACTTTTTCCACAAGGCAGCAGG - Intergenic
919880245 1:201896186-201896208 CACTTGTTGCTCAGGACAGTAGG + Intergenic
919962029 1:202480953-202480975 CAATTTTTCCACAGACTGGTGGG + Intronic
920572024 1:207024610-207024632 GAATTTTTCCACAGGAGAATGGG + Intronic
921812067 1:219526528-219526550 CAATTATTACACAGGATGGTGGG + Intergenic
923130860 1:231073530-231073552 CAAATTATCAACAGGACAGAAGG + Intergenic
923270262 1:232348962-232348984 CACTTCTTCCACAGTACACTGGG + Intergenic
923284077 1:232474537-232474559 TAATTATTCGACAGTACAGTAGG + Intronic
923619500 1:235566585-235566607 CAGTTTTTCCACAGGTCATGGGG - Intronic
923826360 1:237504811-237504833 CAATTTTTCCACGAGCCGGTGGG + Intronic
924277120 1:242400265-242400287 CAATTTTTCCACAAAACTGGGGG - Intronic
924319417 1:242832757-242832779 GACTTTATCCAAAGGACAGTTGG + Intergenic
924576979 1:245289707-245289729 CAATTTTTCTGCAGGAGAGTTGG + Intronic
1062928136 10:1333361-1333383 CAAATTTTCTGCAGCACAGTGGG + Intronic
1063280180 10:4620151-4620173 CAAGGTTTCCACAGGACAGGAGG + Intergenic
1063345580 10:5309417-5309439 CATTTTTTCCAAGGGAGAGTGGG - Intergenic
1063698159 10:8357491-8357513 CAATTTTGCCACGGGGCAGGGGG + Intergenic
1064449902 10:15432315-15432337 TAATTTTTCCACAGACCGGTGGG - Intergenic
1065505849 10:26429474-26429496 CAATTTTTCCACAGATTGGTGGG - Intergenic
1065771038 10:29078868-29078890 GAATTTTTTCACAGGAAAGCTGG + Intergenic
1065875452 10:29993700-29993722 CATTCTTTCCACAGGAGAGTGGG + Intergenic
1067442985 10:46321933-46321955 CAACTTTTCCAGAAGACAGAGGG + Intronic
1068014347 10:51496530-51496552 CAATTTTGCCAAGGGACAGCTGG - Intronic
1071117846 10:82244661-82244683 CAATTTTTTCACAGGCCAGGGGG + Intronic
1071471951 10:85989679-85989701 CAATGTTTCCACGGACCAGTGGG - Intronic
1073585573 10:104706670-104706692 AAATTTATCCACAGGGAAGTGGG - Intronic
1075301051 10:121324598-121324620 CTATTTTTCCACAGATCAGGAGG + Intergenic
1075590371 10:123686859-123686881 CAATTTTTTCATATGACAGTGGG + Intronic
1075880599 10:125847582-125847604 CAATTTTTCCACAGACCAGAGGG + Intronic
1076063731 10:127432104-127432126 CAATTTTTCCACAGACCAGCAGG - Intronic
1076102871 10:127797269-127797291 CCTTTCTTCCACAGGACAGAGGG - Intergenic
1078583462 11:12558535-12558557 CTCTTTCTCCACAGGACAGAAGG - Intergenic
1078949339 11:16111870-16111892 CAATTTTTCCACATGACCAGCGG - Exonic
1080244539 11:30164501-30164523 CAATTTTTCCACAGACCAGGTGG + Intergenic
1080466495 11:32502373-32502395 CAATTTTTCCACAGACCAGGGGG - Intergenic
1080752378 11:35162659-35162681 CAATTAGTTCACAGGGCAGTTGG + Intronic
1081791188 11:45787193-45787215 CAATTTTTCCACAGACCGTTGGG + Intergenic
1083447897 11:62722253-62722275 CAATTTTTGCAGAGGACATGGGG + Exonic
1084988258 11:72897127-72897149 AAATCTTTCCACAGGACGGCCGG - Intronic
1086370650 11:86152363-86152385 CAATTTTTCCTCCAGACAATAGG - Intergenic
1086616289 11:88824493-88824515 CAATTTTTCCACAGGACAGTGGG + Intronic
1087714064 11:101586713-101586735 CAATTTTTCCACGGACCTGTGGG + Intronic
1089215398 11:116831743-116831765 CAATTTTTCCATGGGCCAGCGGG + Intronic
1090499786 11:127250313-127250335 CCACTTTCCCAAAGGACAGTTGG - Intergenic
1090704824 11:129326686-129326708 CAATTTTTCCACAGACCAGGGGG + Intergenic
1092530272 12:9338398-9338420 CAACTTGTCCACAGGACAAAAGG + Intergenic
1092741665 12:11636408-11636430 CAATTTTTCTACAGACCAGGAGG - Intergenic
1093104452 12:15069102-15069124 CAATTTTTCCACAGACCAGGGGG - Intergenic
1093665507 12:21808151-21808173 GAAATTTTCCCCAGGACATTAGG - Intronic
1094090927 12:26648352-26648374 TAATTTTTCTCCAGCACAGTTGG - Intronic
1095323868 12:40863793-40863815 CAATTTTTCCACAGATGAGAAGG - Intronic
1095626270 12:44318579-44318601 CAATTTATGCACAGGAAAGGTGG + Intronic
1095811365 12:46375564-46375586 CAATTTTTCCACAAAAAAATTGG - Intergenic
1097432054 12:59521845-59521867 CAACTTTTCTAAAGGTCAGTGGG - Intergenic
1099408944 12:82300418-82300440 GAAATTTTCCACAGGACACACGG + Intronic
1099438317 12:82669603-82669625 CAAATTTTCCACAGACCAGTCGG + Intergenic
1099863533 12:88249351-88249373 CAATTTTTCCACAGACGGGTTGG - Intergenic
1100709788 12:97243529-97243551 CAACATTTTCACTGGACAGTTGG - Intergenic
1100754833 12:97739722-97739744 CAAATTTGACACATGACAGTAGG - Intergenic
1101182486 12:102234472-102234494 CAATTTTTCCATGGTCCAGTGGG - Intergenic
1101850649 12:108399435-108399457 CAACTTTTCCCCAGGCCACTTGG - Intergenic
1102782250 12:115575414-115575436 CAATTTTTCCACATGAGAAATGG + Intergenic
1103281252 12:119759728-119759750 CAATTTTTCCACAGGGGTGGGGG - Intronic
1104499577 12:129272063-129272085 CAGTTTTTCTACAGCAAAGTCGG + Intronic
1105941941 13:25155404-25155426 CAATATTTATACAGCACAGTGGG + Intergenic
1107545804 13:41432726-41432748 AAATAGTTCCACAGGCCAGTTGG + Intergenic
1109111130 13:58319372-58319394 CAATTTATCCACAGAACCGGGGG - Intergenic
1109227330 13:59712858-59712880 CAATTTTTCCACAGGGGTGAGGG + Intronic
1109753825 13:66732332-66732354 TAAGTTTTCAACAGTACAGTAGG - Intronic
1111880796 13:93954655-93954677 CAAGTGTTCCACAGGACAACTGG - Intronic
1112656849 13:101460823-101460845 CTATTTGTTCACAGGACAGCTGG - Intronic
1112715099 13:102175301-102175323 CAACTTTTCCAAAGATCAGTTGG - Intronic
1113918497 13:113889440-113889462 CAATTTTTCCACAGACCAGAGGG - Intergenic
1114354261 14:21889997-21890019 CAAATTTTCGTCAGGAGAGTTGG + Intergenic
1114458891 14:22874491-22874513 CAATTTTTCCAAAGGGCTCTAGG + Intronic
1116255574 14:42549895-42549917 CAATTTTTCCACAGACTGGTGGG - Intergenic
1119293757 14:73516893-73516915 TAATTTTTCCACAGACCAGCGGG - Intronic
1119331899 14:73801039-73801061 GACTTTATCCACAGGACAGTGGG - Intergenic
1120261533 14:82191077-82191099 CTATTTTTGCACAGGAAATTAGG - Intergenic
1120479576 14:85033493-85033515 CAATTTTTCCACAGACCAGAGGG + Intergenic
1120558265 14:85957109-85957131 CAATTTTTCCAGGGACCAGTTGG - Intergenic
1121107071 14:91287820-91287842 AAATTTTTACAAAGGACACTAGG - Intronic
1122170814 14:99873319-99873341 CTATTTTTCCAAAGGACTATTGG - Intronic
1122615927 14:103017991-103018013 CAATTTTTCCACAGACCCGTAGG + Intronic
1123928698 15:25145515-25145537 AAATTTCTCCAAAGGACAGCAGG + Intergenic
1124162743 15:27288234-27288256 CAGTTTTTCCACAGACCAGGGGG + Intronic
1124450076 15:29780111-29780133 CAATTTTTCCACAGACCGGCAGG + Intronic
1125557867 15:40601291-40601313 CTATTTTTCCACAGACCAGGAGG - Intronic
1125993315 15:44131866-44131888 CAATTTTTCCACAGGTGGGCGGG + Intronic
1127807248 15:62532802-62532824 CAGTTCTTCCTCAGAACAGTGGG + Intronic
1128768619 15:70265998-70266020 TAATTTCTCCACAGGTCCGTGGG - Intergenic
1129315528 15:74740956-74740978 CAATTTTCCCACCAGCCAGTGGG - Intergenic
1130629661 15:85553956-85553978 CAATTTTTCCACAGATGAGGGGG - Intronic
1131402154 15:92133861-92133883 CAATTATTCCACTGACCAGTGGG - Intronic
1131998079 15:98152203-98152225 CACATTTTCCACTGGAAAGTGGG - Intergenic
1132076518 15:98825634-98825656 CAATTTTTCCACAGATGGGTGGG - Intronic
1132215047 15:100056413-100056435 CAATTTTTCCACAGACCAGGGGG + Intronic
1133953952 16:10423586-10423608 ATCTTTTTCCAGAGGACAGTGGG - Intronic
1135433179 16:22404675-22404697 CAATTTTTCCACGGACCAGGGGG - Intronic
1138420458 16:56895674-56895696 CAATTTTTCCACAGGCTTGGGGG + Intronic
1140641138 16:76974860-76974882 CAATTTCTTCACATGAGAGTTGG - Intergenic
1141863979 16:86737092-86737114 CAAGTTTTCCACAGGGCCATGGG - Intergenic
1142546978 17:711291-711313 CAAATTATCCACTGGACACTGGG + Intronic
1147475762 17:40710193-40710215 CAATTTTTCCATAGACCAGGTGG - Intergenic
1147715724 17:42506846-42506868 CAATTCTTCCACAGGCACGTGGG - Intronic
1149485038 17:57036084-57036106 CAATTTGTCCAGAGGGCACTTGG - Intergenic
1150168990 17:62971902-62971924 CAATTTTTCCAGAGGGTAGGGGG - Intergenic
1151143203 17:72015178-72015200 CAAATTGTCCACATGACAGAGGG + Intergenic
1151915122 17:77112150-77112172 CACTTTCTTCACAGGGCAGTAGG - Intronic
1153955456 18:10092065-10092087 CAATTTTTCCACGGACCAGGGGG - Intergenic
1156065320 18:33136197-33136219 CATTTGTTCCACACTACAGTAGG - Intronic
1156194696 18:34760880-34760902 TAAGATATCCACAGGACAGTTGG - Intronic
1156307056 18:35887120-35887142 CAAGTTATCCAAAGCACAGTGGG + Intergenic
1156614311 18:38765286-38765308 AAATTTTTCCACAGGTTATTGGG - Intergenic
1156784998 18:40900664-40900686 CAATATTTCCACTGTACAATTGG + Intergenic
1157375622 18:47161686-47161708 CAATTTTTCCACAGATGGGTTGG + Intronic
1157780291 18:50432393-50432415 CAATTTTTCTACAGACCAGGAGG - Intergenic
1158105795 18:53883664-53883686 CACTTTTTCCTCAGAATAGTTGG + Intergenic
1158346048 18:56518145-56518167 AAATTTTTCCAAAGGGCAGATGG - Intergenic
1158778287 18:60614477-60614499 CAGTTTTTCCACAGGGCAGGGGG - Intergenic
1158885377 18:61821910-61821932 CAATTTTTCCACAGGACGGATGG - Intronic
1159285347 18:66342624-66342646 CAATTTTTCCACAGAATGGTGGG + Intergenic
1159307125 18:66657921-66657943 CAATTTTTCCCCATAACTGTTGG + Intergenic
1159863402 18:73675582-73675604 CGATTTTTCCCAAGGGCAGTGGG - Intergenic
1163148304 19:15397107-15397129 CAATCTACCCACAGGACAGAGGG + Intronic
1163218664 19:15898737-15898759 TAATTTCTCCCCAGGACAATGGG - Intergenic
1163729992 19:18943384-18943406 CATTTTTTGCACAGAACAGACGG - Intergenic
1164668088 19:30055458-30055480 CAATTTTTCAAAAGTACAATTGG - Intergenic
1164749979 19:30646253-30646275 CTATTTTCCACCAGGACAGTTGG - Intronic
1165184275 19:34003445-34003467 CAGTTTTTCTACAGGAAATTAGG - Intergenic
925862077 2:8188689-8188711 CAATTTTTCTACAGACCAGGAGG + Intergenic
926544265 2:14219635-14219657 AAATTTTTCCATTGGACAATTGG - Intergenic
926762748 2:16293594-16293616 CCATCTGTCCACAGGTCAGTGGG - Intergenic
927303839 2:21547517-21547539 AAATCTTTTCACAGGACATTGGG + Intergenic
927943636 2:27121558-27121580 CAATCTTTCCACAGATCAGAAGG + Intergenic
929184532 2:39079905-39079927 CAATTTTTCCACAGACTAGGAGG + Intronic
929239934 2:39643601-39643623 CAATTTTTACACAGGACAGGGGG - Intergenic
929281955 2:40089589-40089611 AAATCTTTGCACATGACAGTAGG - Intergenic
929457737 2:42077860-42077882 TTGTTTTCCCACAGGACAGTGGG - Intergenic
930422767 2:51175148-51175170 CAATTTTTCCACAGACTGGTGGG - Intergenic
935414818 2:102804167-102804189 CAATTTTTCCATAGGTTATTGGG + Intronic
936479957 2:112877044-112877066 CAACTTTTCCAAATGACAATGGG + Intergenic
937483408 2:122287675-122287697 CAATTTTTCCACGGAACCGGGGG - Intergenic
937525673 2:122766454-122766476 CCATTTTGTCACAGGTCAGTTGG - Intergenic
939532837 2:143386391-143386413 CAATTTTTGCAAATGCCAGTGGG + Intronic
939619579 2:144402014-144402036 CAGTTTTATCACAGGCCAGTAGG + Intronic
940359837 2:152785847-152785869 CACTTTCTCCACAAGACAGCAGG + Intergenic
940534005 2:154915210-154915232 CAAAGTTTCTACAGGGCAGTAGG + Intergenic
940714900 2:157210596-157210618 TAAGGTTTCCACTGGACAGTTGG + Intergenic
940986769 2:160058817-160058839 CAAATTTTCCACAGGCCAATGGG + Intronic
942412750 2:175728616-175728638 CAAAATTTACACAGGACAATAGG - Intergenic
943001680 2:182335857-182335879 CAATTTATCCACCTGACAATGGG + Intronic
943244686 2:185431496-185431518 CAATTTTTCCACAGAAGGGGAGG - Intergenic
943776572 2:191772946-191772968 CAATTTTTCCACAGAGGAGTGGG - Intergenic
944111372 2:196134503-196134525 AAATTTTTCCACAGGACTGGGGG - Exonic
944157428 2:196622091-196622113 CAAATTTTCCAAAGGAGAGAAGG - Intergenic
945013358 2:205488246-205488268 CAATTTTTCCACAGGGCGGGGGG + Intronic
945027467 2:205632731-205632753 CAACTTTTCCACAGTCCAGAGGG - Intergenic
945106272 2:206318507-206318529 TCATTTTTCTACTGGACAGTGGG - Intergenic
945797338 2:214381064-214381086 CTTTTTTTCCCCAGGAAAGTTGG + Intronic
946682855 2:222235550-222235572 CAATTTTTTCAGAGGATTGTGGG + Intronic
946707676 2:222474855-222474877 TAATTTTTCCAAAGGAAATTAGG - Intronic
946779337 2:223176787-223176809 CAATTTTTCCACAGGATCAGCGG - Intronic
946803583 2:223447547-223447569 CAATTGTTCCTCAGGAAAGATGG - Intergenic
947230269 2:227877598-227877620 CAATTTTTCCACAGACCAGGGGG + Intronic
947879837 2:233498065-233498087 TAATTTTATCACAGGAGAGTTGG - Intronic
949058875 2:241945094-241945116 CCATGTTTCCACAGGAGACTTGG - Intergenic
1170262472 20:14425668-14425690 TAATTTGTTCACAGGACAGGAGG - Intronic
1170856238 20:20058191-20058213 CAATTTTACTAGAGGGCAGTAGG + Intronic
1172757076 20:37293128-37293150 CAATTTTTCCACAGACCTGGGGG + Intronic
1173310475 20:41892361-41892383 CCAGTGTTCCACAGGACAGGTGG - Intergenic
1173864404 20:46305218-46305240 CAACTTTTCATCAGGGCAGTGGG - Intronic
1174167018 20:48592346-48592368 CAATTTTTCCACAGACCAGGGGG + Intergenic
1174445090 20:50585551-50585573 CAATTTTTTCACAGGCCTGGGGG + Intergenic
1174633745 20:51980823-51980845 CAATTTTTCCACAGACCCGCTGG - Intergenic
1175337985 20:58208764-58208786 CAATTTTTCCACGGACCAGAGGG + Intergenic
1177431332 21:20996022-20996044 CAATTTTTCAACCTGACACTGGG - Intergenic
1180249421 21:46571265-46571287 CAATTATTCCACAGACCAGGGGG - Intergenic
1181379766 22:22492479-22492501 GAGTTTTCCCACAGGACATTTGG - Intronic
1181575209 22:23789828-23789850 CCTGTTTTCCACAGGGCAGTGGG - Intronic
1184322060 22:43749437-43749459 CAATTTTTCCATGGGCCAGTGGG + Intronic
1185007859 22:48294630-48294652 CAATTCTACCACAGGAGAATTGG - Intergenic
949761704 3:7478246-7478268 CGGTTTTTCAACAGGTCAGTGGG - Intronic
950663804 3:14482779-14482801 CTATTTTTTCAGAGGACAGAGGG + Intronic
951295938 3:20934621-20934643 AAATTTTTCCACAGACCAGCAGG - Intergenic
951705718 3:25542414-25542436 TAATTTTTCCAAAGGAAATTAGG + Intronic
951937970 3:28043241-28043263 CACTTTTTCCACTGGAAACTGGG - Intergenic
951944570 3:28120653-28120675 TAATTTTTCTACAGCACAGTAGG - Intergenic
952323577 3:32300365-32300387 CAATTCTTACACAGAAAAGTAGG + Intronic
952643842 3:35631659-35631681 CAATTTTTCCACAGGGGATAGGG - Intergenic
953768740 3:45763128-45763150 CCAGTTCTCTACAGGACAGTGGG + Intronic
955047866 3:55376818-55376840 TAATTTTTCCACTGACCAGTTGG - Intergenic
956315684 3:67933956-67933978 CAATTTTTCCACAGATGGGTTGG + Intergenic
956899683 3:73702358-73702380 CAATTTTTCTACGGGACAGCAGG - Intergenic
957160666 3:76605568-76605590 GAATTTTTCCATAGGAAAGTTGG + Intronic
957876267 3:86150342-86150364 CAAATTTTCCAGAGAACAATGGG - Intergenic
958056510 3:88419231-88419253 CAATTTTTCCACAGACCAGGGGG - Intergenic
961503447 3:127354428-127354450 CAGCTTTTCCAGAGGACCGTTGG + Intergenic
962285487 3:134082624-134082646 CAATTTTTCCACAGACCTGGAGG - Intronic
962631945 3:137285773-137285795 CCATATTTCCTCAGCACAGTTGG - Intergenic
964501698 3:157355036-157355058 CCTTCTTTCCACAGGACAGACGG + Intronic
964744156 3:159996815-159996837 CAATTTTTCCACAGACCCGGGGG - Intergenic
965471731 3:169101848-169101870 GAATTTTAACACAGGACATTTGG - Intronic
965569855 3:170161404-170161426 CAATTTTTCCACAGAGAAGGTGG + Intronic
965778565 3:172259247-172259269 TTATTTTTTCAAAGGACAGTGGG + Intronic
965880173 3:173379792-173379814 CAATTTTGCCAAAGGTCAGTTGG + Intergenic
966533660 3:181007793-181007815 CAATTTTTCCACAGACCGGAGGG - Intergenic
967671419 3:192239766-192239788 CAATTTTTCCACAGACTAGTTGG - Intronic
968115509 3:196086300-196086322 CCATGTTTCCGCAGCACAGTGGG - Intergenic
968257163 3:197286329-197286351 CAATTTTTCCACAGAAAAGAGGG + Intronic
968855784 4:3120718-3120740 CAATTTTTCCACAGGGCCAGGGG - Intronic
968948849 4:3679867-3679889 CAATGTTTTCAGAGGACAGGAGG + Intergenic
969825450 4:9754329-9754351 AAATAGTTCCACAGGCCAGTTGG - Intergenic
969863859 4:10059464-10059486 CAATTTTTTAAAAGGTCAGTGGG + Intergenic
970514151 4:16810939-16810961 CAATTTTTCCACAGACTGGTGGG + Intronic
970970353 4:21975907-21975929 GAATTTTTCCACAGGAAAGTGGG + Intergenic
970997747 4:22287189-22287211 CATTTTTTCCCCAAGACTGTTGG + Intergenic
971091887 4:23355123-23355145 CAATTTATCTACAGGAAACTAGG + Intergenic
972591614 4:40493397-40493419 CAATGTGTCCACAGAACACTTGG + Intronic
972975722 4:44633162-44633184 CAATTTTTCCACAGCCAGGTTGG - Intronic
973145458 4:46820034-46820056 CAATTTTTTCACAGACCAGTCGG + Intronic
973836952 4:54819277-54819299 GAATTATTCCAGAGGACATTTGG - Intergenic
973999226 4:56493979-56494001 CACTTCTTCCTGAGGACAGTGGG + Intronic
974432314 4:61815324-61815346 TTATTTTTCCCCAGGTCAGTTGG + Intronic
975337871 4:73202064-73202086 CAAATTTGCCACAGCACAGTAGG + Intronic
975960744 4:79901557-79901579 CAATTTTTCCACAGACCGGGGGG + Intronic
976231882 4:82852840-82852862 CAATTTTTCCACAGGCCAGCAGG + Intronic
976845424 4:89483625-89483647 CAATTTTTCCACAGGCCAGCAGG - Intergenic
977001633 4:91511913-91511935 CAATTTTTCCACAGACCACTGGG - Intronic
977052160 4:92142242-92142264 AACCTTTTCCTCAGGACAGTAGG - Intergenic
977486226 4:97649804-97649826 CAAGTTTTCCACAGACCAGGGGG + Intronic
977612527 4:99050831-99050853 GAATTTTTCCACAGACCAGGAGG - Intronic
977956819 4:103037334-103037356 CAATTTTACCATAGGCCAATTGG - Intronic
978360034 4:107921711-107921733 CAATTTTTCCACGGACCAGCAGG + Intergenic
979557446 4:122065786-122065808 CAATTTTTCCACGGACGAGTGGG + Intergenic
980675936 4:136080781-136080803 CAGCTTTTTCACAGGGCAGTAGG + Intergenic
981106924 4:140891978-140892000 GAATTTTTCCACAAGAGAGGTGG - Intronic
981980008 4:150780792-150780814 CAATTTTTCCACAGACAAGGGGG + Intronic
982070998 4:151694231-151694253 AAATTATTCCACAGGAAATTGGG + Intronic
982164778 4:152604653-152604675 CAATTTTTCCACGAGGCAGAGGG - Intergenic
983312106 4:166077804-166077826 AAATCTTTCAACAGGGCAGTGGG + Intronic
983439734 4:167766136-167766158 CAAATTTTCCACAGACCAGTGGG + Intergenic
984199749 4:176703550-176703572 CTAGTATTCCACAGCACAGTAGG + Intronic
985105781 4:186498696-186498718 CTGTGTTTCTACAGGACAGTGGG + Intronic
986935739 5:12883764-12883786 CAATTTTTCCACAGAAGAGGAGG - Intergenic
987017898 5:13838744-13838766 CAATTTTTCTACAGACCAGGGGG - Intronic
987138393 5:14920830-14920852 CAATTTTTACACAGGGATGTGGG - Intergenic
987866705 5:23550016-23550038 CAATTTTTACATAGAACAGCAGG - Intergenic
988148803 5:27348358-27348380 CAATTTTTCACCAGGATAATTGG + Intergenic
988573268 5:32393192-32393214 AAATTATTCCACAGAATAGTGGG - Intronic
988638740 5:33017417-33017439 CTATTATTCCAAAGAACAGTAGG - Intergenic
988950055 5:36246775-36246797 CAATTTTTCCACAGGCTAGGGGG - Intergenic
989512435 5:42303818-42303840 CAATTTTTCCACAGACTTGTTGG - Intergenic
989992075 5:50778407-50778429 CAATATTTTCACAAAACAGTGGG + Intronic
990206014 5:53430317-53430339 CAGTTTTTACACAGGAAAGTGGG - Intergenic
990873535 5:60459809-60459831 AAATTTTTAAACAGGAAAGTTGG + Intronic
993504623 5:88694185-88694207 AAAATTTTCCACAAGAAAGTGGG - Intergenic
995903140 5:117093363-117093385 CTAGTTTTCCATAGCACAGTAGG - Intergenic
997074069 5:130651515-130651537 CAACTTTTCCACAAGAGACTTGG + Intergenic
997839893 5:137229699-137229721 AAATTTTTCCACAGACCAGGAGG + Intronic
997889258 5:137660411-137660433 CCAGCTTCCCACAGGACAGTGGG + Intronic
997929049 5:138057361-138057383 CAATTTTACCACAGGCTAATTGG + Intergenic
999825672 5:155271474-155271496 CAATTTCTCCCCAGGACTGGGGG + Intergenic
1001225390 5:169940416-169940438 CAATTTTTCCACAGACCGGGAGG + Intronic
1001867743 5:175120215-175120237 CAATTTTTCCACAGACCAAAAGG + Intergenic
1002563009 5:180095144-180095166 CCATTTTTCCATTGGATAGTTGG + Intergenic
1004034748 6:11912649-11912671 CAATTTTTCCACAGACCAGAAGG - Intergenic
1004078502 6:12367771-12367793 TTATTTCTCCATAGGACAGTTGG - Intergenic
1004854048 6:19731330-19731352 TAATATTTCCAGATGACAGTTGG - Intergenic
1005100018 6:22161357-22161379 CAATTTTTCCACAGAACAGAAGG - Intergenic
1005103976 6:22203398-22203420 CAATTTTTCCACAGACCACGGGG - Intergenic
1006802364 6:36767374-36767396 CAATTTTCCCATCTGACAGTGGG - Intronic
1007327757 6:41074537-41074559 TAATTCTTCCACAGGAAAGATGG + Intronic
1008459923 6:51756885-51756907 CAATTTTTCCACAGGGGAGGTGG + Intronic
1008931845 6:56948574-56948596 CAATATTTTCACACCACAGTTGG + Intronic
1009551902 6:65107652-65107674 TTATTTTCCCACAGTACAGTGGG + Intronic
1010122266 6:72390271-72390293 TTATCTTTCCACAGAACAGTTGG + Intronic
1010175552 6:73023926-73023948 CAATTTTTTCAAAGGACAAAGGG + Intronic
1011045087 6:83072945-83072967 CTATTTTTTCACAGGCCAGCAGG - Intronic
1011637597 6:89388653-89388675 CAATTTTTCCAGGGACCAGTGGG + Intronic
1011913923 6:92478084-92478106 CAGTTTTTCCACAGCACTCTTGG - Intergenic
1012133637 6:95527549-95527571 CAATTTTCCTACAGGTAAGTTGG - Intergenic
1012413208 6:98983816-98983838 CAATGTATGCACAGCACAGTAGG - Intergenic
1013562097 6:111315886-111315908 CAATTTTTCCGCAGACCAGGTGG - Intronic
1015226593 6:130864098-130864120 CAATTTTTAAAAAGGAGAGTAGG + Intronic
1015818975 6:137239993-137240015 TAATTTTTCCACAGGATTTTGGG + Intergenic
1017375361 6:153761865-153761887 CAATTTTTCCACAAACCAGTTGG + Intergenic
1017566570 6:155693387-155693409 GAAATATTCCACAGGATAGTTGG - Intergenic
1018861975 6:167717600-167717622 CAAGGTTTCCACAGGACCCTGGG - Intergenic
1019852136 7:3570203-3570225 TAGTTTTTCCACAGCCCAGTGGG + Intronic
1019866177 7:3712528-3712550 CAATTTATCCACAGACCAGAGGG - Intronic
1019923487 7:4177676-4177698 CAATTTTTCCATAGACCAGGTGG + Intronic
1020250758 7:6466525-6466547 CAATTTTTCCACAGACCAGCAGG + Intronic
1020708061 7:11570412-11570434 CAAGTTTTCAATAGCACAGTTGG + Intronic
1021248645 7:18295993-18296015 GAATTTTTCTGCAGGAGAGTGGG + Intronic
1021652585 7:22846329-22846351 CAATTTTTCCACAGACCCGTGGG + Intergenic
1022306056 7:29147402-29147424 CAATTTTTCCCCCTGACTGTCGG - Intronic
1023070274 7:36424136-36424158 CCTTTTTTCCACATGACTGTAGG + Intronic
1023277478 7:38535484-38535506 CAATTTTTCCACTGACCAGAGGG + Intronic
1024614000 7:51092225-51092247 CAATTTTTCCACGGACCAGTGGG - Intronic
1024728711 7:52230824-52230846 CAATTTTTCCACAGACTGGTGGG + Intergenic
1025019125 7:55466948-55466970 CAATTTTTCCACGGACCAGGGGG + Intronic
1026452661 7:70543079-70543101 TTATATTTCCACAAGACAGTTGG - Intronic
1028106535 7:86885689-86885711 CTCTTTTCCCACAGGAGAGTAGG - Intronic
1028649666 7:93137616-93137638 CAATTTTTCCACAGGGTAGTGGG - Intronic
1029263891 7:99324000-99324022 CAATTTTTCCACGGAAAAGGGGG + Intergenic
1031169687 7:118277041-118277063 CAATTTTTCCACAGAGGAGGTGG - Intergenic
1031472259 7:122181100-122181122 CCATTTTTTCACATGACTGTTGG + Intergenic
1032707260 7:134432225-134432247 CAATTTTTCCACAGACCTGGCGG + Intergenic
1032795577 7:135273572-135273594 CAATTTTTCCACAGACTGGTTGG + Intergenic
1033312306 7:140270934-140270956 CAAAATTTCCACAGTACAGAAGG + Intergenic
1033821282 7:145137471-145137493 CAAATTCTTCACAGGACAGCTGG - Intergenic
1036289934 8:7478322-7478344 CAATTTATCCACATGATACTGGG - Intergenic
1036331543 8:7833205-7833227 CAATTTATCCACATGATACTGGG + Intergenic
1037266939 8:17073626-17073648 CAATTTTTCCACAGACCAGGAGG - Intronic
1037790233 8:21932727-21932749 CAATTGGACCACAGGTCAGTAGG + Intronic
1039037362 8:33374209-33374231 CAATTTTTCCACAGACCGGTAGG - Intronic
1039056760 8:33542954-33542976 CTAATATTCCACAGGAGAGTAGG + Intergenic
1040528919 8:48249562-48249584 TTTTTTTTCCAGAGGACAGTGGG - Intergenic
1040771495 8:50982927-50982949 CAAGGTAACCACAGGACAGTAGG - Intergenic
1041928296 8:63260515-63260537 CAATTTTTCCGCAGGGGATTGGG - Intergenic
1043107119 8:76127982-76128004 CATTTCTTGCACAGCACAGTAGG + Intergenic
1044165392 8:88976229-88976251 CAATTTTTCCATCGGACAAAGGG + Intergenic
1047823193 8:128543951-128543973 CAATATTCCCAAAGGAGAGTGGG + Intergenic
1048933132 8:139332496-139332518 CAATTTTACCTCAGTACAGCCGG + Intergenic
1050207341 9:3210983-3211005 CATTTTTTCCACAAAACAGAAGG + Intergenic
1050486884 9:6143720-6143742 CAATTTTTCCACAGACCGGTTGG + Intergenic
1050616581 9:7407542-7407564 GGATTTTTACAAAGGACAGTTGG - Intergenic
1051399207 9:16661105-16661127 CAATTTTACCACATGACGTTGGG - Intronic
1051550036 9:18317557-18317579 CAATTATGCCTCAGGAAAGTTGG + Intergenic
1051688288 9:19681579-19681601 CAGTTCCTCCACAGGACCGTGGG - Intronic
1052296092 9:26897289-26897311 AAATTTTTATTCAGGACAGTGGG - Intergenic
1052401322 9:28003778-28003800 CAATTTTACCACAGACCAATTGG - Intronic
1052564700 9:30134451-30134473 CAATTTTTCCACAGGATGTTGGG + Intergenic
1056432890 9:86546278-86546300 CAATTGTTCTAAAGGAGAGTTGG - Intergenic
1057956893 9:99417118-99417140 TAATTTTCCCAGGGGACAGTAGG + Intergenic
1059051620 9:110932828-110932850 CAATTTTTCCACAGATGGGTTGG - Intronic
1060144755 9:121242437-121242459 CCCTTTTTCCAGAGGACAGCAGG - Intronic
1061976615 9:134071200-134071222 CAATTTTTCCACGGATGAGTGGG + Intergenic
1062133291 9:134911958-134911980 CAATCATGCCACAGGGCAGTGGG + Intronic
1062367165 9:136216349-136216371 CATTTTGTCCAAAGGACAGGTGG + Intronic
1186237763 X:7531824-7531846 CAATTTTTCTGCAGGCCAGCAGG + Intergenic
1186441621 X:9591826-9591848 GAATTTTTCCCCTGGGCAGTAGG + Intronic
1188144619 X:26595711-26595733 CTAGTTTTCCATAGCACAGTAGG + Intergenic
1189553756 X:42120163-42120185 CAATTTTTCCACAGGGCAAAAGG + Intergenic
1192206669 X:69100982-69101004 CCATATTTCCCCATGACAGTGGG - Intergenic
1194678248 X:96818867-96818889 CAATTTTACCACGGGACGGGCGG + Intronic
1196394640 X:115246242-115246264 CAATTTTTCCACAGACCAGTTGG + Intergenic
1197127127 X:122959741-122959763 CAATTATTTCACAGTACAGGAGG - Intergenic
1197549592 X:127873564-127873586 CAATTCTTCCACAGACCAGGGGG + Intergenic
1198188812 X:134283267-134283289 CAATTTTTCCACAGACTGGTGGG - Intergenic
1198624312 X:138552323-138552345 CACTCTTTCCTCAGGACACTTGG + Intergenic
1199049851 X:143224272-143224294 GAATTTTTCCTGGGGACAGTGGG + Intergenic